Incidental Mutation 'R1367:Cd209e'
ID 156074
Institutional Source Beutler Lab
Gene Symbol Cd209e
Ensembl Gene ENSMUSG00000040197
Gene Name CD209e antigen
Synonyms SIGNR4, mSIGNR4
MMRRC Submission 039432-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R1367 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 3897973-3904286 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 3899084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 209 (*209W)
Ref Sequence ENSEMBL: ENSMUSP00000033888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033888]
AlphaFold Q91ZW7
Predicted Effect probably null
Transcript: ENSMUST00000033888
AA Change: *209W
SMART Domains Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: *209W

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 77 198 4.01e-33 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,261,250 (GRCm39) V676A probably damaging Het
Acvr1b T C 15: 101,091,819 (GRCm39) L33P possibly damaging Het
Adamts12 T G 15: 11,256,980 (GRCm39) probably benign Het
Ank1 T A 8: 23,601,819 (GRCm39) probably benign Het
Arhgef10 T A 8: 14,990,225 (GRCm39) D233E probably damaging Het
Cebpz A G 17: 79,230,742 (GRCm39) V825A probably benign Het
Cep170 A G 1: 176,563,290 (GRCm39) F1575L probably damaging Het
Exoc2 A T 13: 31,066,256 (GRCm39) Y473* probably null Het
F3 A G 3: 121,523,023 (GRCm39) T78A probably damaging Het
Fanca G A 8: 124,031,020 (GRCm39) probably benign Het
Gga2 G A 7: 121,598,138 (GRCm39) R319* probably null Het
Gid8 A G 2: 180,355,025 (GRCm39) I10M probably benign Het
Glrb A G 3: 80,769,311 (GRCm39) W139R probably damaging Het
H2-M1 A G 17: 36,982,059 (GRCm39) S181P probably benign Het
Hectd3 G T 4: 116,854,367 (GRCm39) V310L probably null Het
Insyn1 G T 9: 58,406,263 (GRCm39) D58Y probably damaging Het
Kif17 C A 4: 138,005,305 (GRCm39) S290* probably null Het
Kif26b A G 1: 178,744,028 (GRCm39) N1375D probably damaging Het
Lgr4 C G 2: 109,821,480 (GRCm39) P121A probably damaging Het
Ly75 A G 2: 60,124,102 (GRCm39) probably null Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Nek3 T C 8: 22,650,377 (GRCm39) probably benign Het
Nin A T 12: 70,090,703 (GRCm39) L904Q probably damaging Het
Nlrp14 A G 7: 106,782,018 (GRCm39) D405G probably benign Het
Nuak1 C T 10: 84,228,192 (GRCm39) probably benign Het
Or5h23 T A 16: 58,906,706 (GRCm39) I47F probably benign Het
Plcg2 T A 8: 118,341,977 (GRCm39) W1113R probably damaging Het
Pms2 G A 5: 143,862,731 (GRCm39) V613M probably damaging Het
Prl3b1 G A 13: 27,427,848 (GRCm39) A53T probably benign Het
Pxk T G 14: 8,150,915 (GRCm38) probably null Het
Rasl10b G A 11: 83,308,665 (GRCm39) probably null Het
Rbm28 A T 6: 29,137,639 (GRCm39) I438N probably damaging Het
Rictor T C 15: 6,820,119 (GRCm39) probably benign Het
Slc41a1 A G 1: 131,771,746 (GRCm39) T387A probably benign Het
Slc44a2 T C 9: 21,254,322 (GRCm39) V228A probably benign Het
Slpi A G 2: 164,196,787 (GRCm39) probably benign Het
Tkfc A G 19: 10,570,838 (GRCm39) S481P probably benign Het
Tll2 G A 19: 41,108,667 (GRCm39) R328C probably damaging Het
Tns3 T C 11: 8,398,704 (GRCm39) H1216R probably benign Het
Ugt2b38 A T 5: 87,571,973 (GRCm39) S20T probably benign Het
Usp48 T A 4: 137,366,606 (GRCm39) D921E possibly damaging Het
Usp48 T A 4: 137,371,774 (GRCm39) S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Zdhhc23 A G 16: 43,794,513 (GRCm39) S54P probably benign Het
Other mutations in Cd209e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cd209e APN 8 3,902,800 (GRCm39) missense probably benign 0.05
IGL00920:Cd209e APN 8 3,899,187 (GRCm39) missense probably damaging 1.00
IGL01132:Cd209e APN 8 3,901,274 (GRCm39) missense probably benign 0.18
IGL02499:Cd209e APN 8 3,904,238 (GRCm39) missense probably benign
R0124:Cd209e UTSW 8 3,901,274 (GRCm39) missense probably benign 0.08
R0268:Cd209e UTSW 8 3,899,125 (GRCm39) missense probably benign 0.34
R0540:Cd209e UTSW 8 3,901,265 (GRCm39) missense probably benign 0.04
R0744:Cd209e UTSW 8 3,903,205 (GRCm39) missense probably benign 0.00
R0836:Cd209e UTSW 8 3,903,205 (GRCm39) missense probably benign 0.00
R1241:Cd209e UTSW 8 3,899,124 (GRCm39) missense probably damaging 0.99
R2040:Cd209e UTSW 8 3,899,158 (GRCm39) missense probably damaging 1.00
R2136:Cd209e UTSW 8 3,903,248 (GRCm39) missense probably benign 0.00
R4787:Cd209e UTSW 8 3,901,181 (GRCm39) missense probably null 0.69
R6283:Cd209e UTSW 8 3,899,212 (GRCm39) nonsense probably null
R6338:Cd209e UTSW 8 3,899,154 (GRCm39) missense probably damaging 1.00
R6894:Cd209e UTSW 8 3,903,569 (GRCm39) missense possibly damaging 0.48
R8899:Cd209e UTSW 8 3,901,212 (GRCm39) nonsense probably null
R9594:Cd209e UTSW 8 3,901,183 (GRCm39) missense probably benign 0.00
Z1176:Cd209e UTSW 8 3,899,196 (GRCm39) missense probably benign 0.30
Z1177:Cd209e UTSW 8 3,901,181 (GRCm39) missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGACATCAAAGGAAGGACCTCAG -3'
(R):5'- AAGACTTCATACGATGCAGGTAGCAC -3'

Sequencing Primer
(F):5'- AAGGACCTCAGTGGTCTAGC -3'
(R):5'- gctatcctggaccgttgtg -3'
Posted On 2014-02-11