Incidental Mutation 'R1367:Slc44a2'
ID156080
Institutional Source Beutler Lab
Gene Symbol Slc44a2
Ensembl Gene ENSMUSG00000057193
Gene Namesolute carrier family 44, member 2
Synonyms1110028E10Rik, CTL2
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21320698-21355028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21343026 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000150147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034697] [ENSMUST00000215574] [ENSMUST00000217461]
Predicted Effect probably benign
Transcript: ENSMUST00000034697
AA Change: V230A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034697
Gene: ENSMUSG00000057193
AA Change: V230A

DomainStartEndE-ValueType
Blast:CLECT 4 37 8e-8 BLAST
transmembrane domain 231 253 N/A INTRINSIC
transmembrane domain 255 277 N/A INTRINSIC
Pfam:Choline_transpo 319 678 3.9e-119 PFAM
low complexity region 691 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213758
Predicted Effect probably benign
Transcript: ENSMUST00000214268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215528
Predicted Effect probably benign
Transcript: ENSMUST00000215574
AA Change: V228A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217453
Predicted Effect probably benign
Transcript: ENSMUST00000217461
AA Change: V228A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0888 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cochlear hair cell loss, spiral ganglion degeneration, and progressive sensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Slc44a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Slc44a2 APN 9 21345935 missense probably damaging 0.96
IGL01506:Slc44a2 APN 9 21337950 missense probably benign 0.30
IGL01687:Slc44a2 APN 9 21345947 missense probably benign 0.00
IGL01786:Slc44a2 APN 9 21352486 missense probably damaging 1.00
IGL01795:Slc44a2 APN 9 21345349 missense probably damaging 0.97
IGL02338:Slc44a2 APN 9 21347042 missense probably damaging 1.00
IGL02701:Slc44a2 APN 9 21347951 missense probably benign 0.01
IGL02820:Slc44a2 APN 9 21342977 missense probably benign
IGL03087:Slc44a2 APN 9 21346765 missense probably benign 0.00
IGL03153:Slc44a2 APN 9 21343200 missense probably benign 0.44
IGL03233:Slc44a2 APN 9 21348622 missense possibly damaging 0.95
Loaded UTSW 9 21348149 critical splice donor site probably null
R1177:Slc44a2 UTSW 9 21348583 missense probably benign 0.00
R1474:Slc44a2 UTSW 9 21353694 missense probably damaging 0.99
R2077:Slc44a2 UTSW 9 21353724 missense probably damaging 1.00
R2432:Slc44a2 UTSW 9 21344834 missense probably damaging 1.00
R3722:Slc44a2 UTSW 9 21342977 missense possibly damaging 0.78
R3958:Slc44a2 UTSW 9 21348541 missense probably damaging 0.96
R4557:Slc44a2 UTSW 9 21346783 missense possibly damaging 0.93
R4641:Slc44a2 UTSW 9 21346882 missense probably damaging 1.00
R4725:Slc44a2 UTSW 9 21348395 missense probably damaging 1.00
R4859:Slc44a2 UTSW 9 21348145 missense probably damaging 0.98
R6701:Slc44a2 UTSW 9 21320853 critical splice donor site probably null
R7068:Slc44a2 UTSW 9 21320848 missense probably benign 0.00
R7206:Slc44a2 UTSW 9 21346807 missense probably damaging 1.00
R7233:Slc44a2 UTSW 9 21348149 critical splice donor site probably null
R7287:Slc44a2 UTSW 9 21342456 missense probably benign
R7329:Slc44a2 UTSW 9 21342752 missense probably damaging 1.00
R7432:Slc44a2 UTSW 9 21343215 missense probably benign 0.00
R7442:Slc44a2 UTSW 9 21345523 missense probably damaging 1.00
R7448:Slc44a2 UTSW 9 21348346 missense possibly damaging 0.87
R7514:Slc44a2 UTSW 9 21342472 missense possibly damaging 0.46
R7523:Slc44a2 UTSW 9 21345992 missense probably null 0.81
X0018:Slc44a2 UTSW 9 21342788 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGGGCAATGAGACGACCTATG -3'
(R):5'- TAATGCCAGCCAGGAATCGCAG -3'

Sequencing Primer
(F):5'- CATTACAGATCTAGTGGAGGGTGC -3'
(R):5'- TCGCAGCAGGACGATGAAC -3'
Posted On2014-02-11