Incidental Mutation 'R1367:Nuak1'
ID156082
Institutional Source Beutler Lab
Gene Symbol Nuak1
Ensembl Gene ENSMUSG00000020032
Gene NameNUAK family, SNF1-like kinase, 1
Synonyms
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location84370905-84440597 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 84392328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020220]
Predicted Effect probably benign
Transcript: ENSMUST00000020220
SMART Domains Protein: ENSMUSP00000020220
Gene: ENSMUSG00000020032

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
S_TKc 56 307 2.3e-105 SMART
low complexity region 475 490 N/A INTRINSIC
low complexity region 559 589 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000129355
SMART Domains Protein: ENSMUSP00000122927
Gene: ENSMUSG00000020032

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 156 3.1e-19 PFAM
Pfam:Pkinase 19 158 3.5e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene die perinatally displaying omphalocele with a failure in closure of the secondary body wall. No gross morphological defects are detected in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Nuak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nuak1 APN 10 84375134 missense probably damaging 1.00
IGL01374:Nuak1 APN 10 84374668 missense probably damaging 0.96
IGL02967:Nuak1 APN 10 84440221 missense probably damaging 1.00
IGL03207:Nuak1 APN 10 84440129 missense possibly damaging 0.84
R0002:Nuak1 UTSW 10 84375367 missense probably damaging 1.00
R0277:Nuak1 UTSW 10 84374451 missense probably benign 0.02
R0749:Nuak1 UTSW 10 84374784 missense probably damaging 1.00
R0906:Nuak1 UTSW 10 84375280 missense probably damaging 1.00
R1227:Nuak1 UTSW 10 84440309 missense probably benign
R1778:Nuak1 UTSW 10 84374874 splice site probably null
R2151:Nuak1 UTSW 10 84409645 missense probably benign 0.00
R2877:Nuak1 UTSW 10 84375345 missense possibly damaging 0.79
R3863:Nuak1 UTSW 10 84378087 splice site probably null
R4386:Nuak1 UTSW 10 84394044 missense probably damaging 1.00
R4849:Nuak1 UTSW 10 84375279 missense probably damaging 1.00
R4962:Nuak1 UTSW 10 84375115 missense probably damaging 1.00
R5118:Nuak1 UTSW 10 84374984 missense probably benign 0.04
R5134:Nuak1 UTSW 10 84374350 missense probably benign 0.01
R5248:Nuak1 UTSW 10 84409678 missense probably damaging 1.00
R5590:Nuak1 UTSW 10 84375255 missense probably benign
R5719:Nuak1 UTSW 10 84409720 missense probably damaging 1.00
R5933:Nuak1 UTSW 10 84374802 missense probably damaging 0.99
R7067:Nuak1 UTSW 10 84440294 missense possibly damaging 0.59
R7169:Nuak1 UTSW 10 84374745 missense probably damaging 1.00
R7342:Nuak1 UTSW 10 84374967 missense probably damaging 1.00
R7549:Nuak1 UTSW 10 84374539 missense probably benign 0.08
R8351:Nuak1 UTSW 10 84394117 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATGAGAGTCTTTCCCAGAGCCC -3'
(R):5'- AATGCTCTCCTGTCGCTGGTTG -3'

Sequencing Primer
(F):5'- CACCAACCAGCAGAGGGAG -3'
(R):5'- CGTCCTGACAGTGAGAGCAG -3'
Posted On2014-02-11