Incidental Mutation 'R1367:Rasl10b'
ID156085
Institutional Source Beutler Lab
Gene Symbol Rasl10b
Ensembl Gene ENSMUSG00000020684
Gene NameRAS-like, family 10, member B
SynonymsB230331P10Rik, VTS58635
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83409137-83421039 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 83417839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021022] [ENSMUST00000021022] [ENSMUST00000052521] [ENSMUST00000108140] [ENSMUST00000108140] [ENSMUST00000147301] [ENSMUST00000164425] [ENSMUST00000164425] [ENSMUST00000175848] [ENSMUST00000175848]
Predicted Effect probably null
Transcript: ENSMUST00000021022
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021022
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052521
SMART Domains Protein: ENSMUSP00000051907
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 200 N/A INTRINSIC
Pfam:GAS2 206 274 1.2e-35 PFAM
low complexity region 444 460 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108140
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108140
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147301
SMART Domains Protein: ENSMUSP00000119454
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164425
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164425
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have smaller than normal large dense-core vesicles in atrial myocytes and exhibit impaired atrial natriuretic peptide secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Rasl10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Rasl10b APN 11 83417853 missense probably damaging 1.00
R0378:Rasl10b UTSW 11 83418693 missense probably damaging 1.00
R0772:Rasl10b UTSW 11 83417839 splice site probably null
R0773:Rasl10b UTSW 11 83417839 splice site probably null
R0829:Rasl10b UTSW 11 83417839 splice site probably null
R0830:Rasl10b UTSW 11 83417839 splice site probably null
R0831:Rasl10b UTSW 11 83417839 splice site probably null
R1363:Rasl10b UTSW 11 83417839 splice site probably null
R1364:Rasl10b UTSW 11 83417839 splice site probably null
R1365:Rasl10b UTSW 11 83417839 splice site probably null
R1366:Rasl10b UTSW 11 83417839 splice site probably null
R1368:Rasl10b UTSW 11 83417839 splice site probably null
R1389:Rasl10b UTSW 11 83417839 splice site probably null
R3771:Rasl10b UTSW 11 83418523 missense probably benign 0.04
R4925:Rasl10b UTSW 11 83412679 missense probably damaging 1.00
R5625:Rasl10b UTSW 11 83418814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCACAAAATAGTGTGGTGGGC -3'
(R):5'- TGTACCCCTCTTTTGGAGACAGGC -3'

Sequencing Primer
(F):5'- CCAGGAAGTAACCAGCTTGTG -3'
(R):5'- TTTTGGAGACAGGCCAGCATC -3'
Posted On2014-02-11