Incidental Mutation 'R1367:Prl3b1'
ID156087
Institutional Source Beutler Lab
Gene Symbol Prl3b1
Ensembl Gene ENSMUSG00000038891
Gene Nameprolactin family 3, subfamily b, member 1
SynonymsmplII, Csh2, Pl2, prolactin-like, Pl-2, PL, mPL-II
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27241847-27249683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27243865 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 53 (A53T)
Ref Sequence ENSEMBL: ENSMUSP00000047680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035273] [ENSMUST00000225089]
Predicted Effect probably benign
Transcript: ENSMUST00000035273
AA Change: A53T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047680
Gene: ENSMUSG00000038891
AA Change: A53T

DomainStartEndE-ValueType
Pfam:Hormone_1 18 222 1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225089
AA Change: A53T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Prl3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Prl3b1 APN 13 27249383 missense possibly damaging 0.51
IGL02669:Prl3b1 APN 13 27245812 missense probably benign 0.24
IGL03035:Prl3b1 APN 13 27249533 unclassified probably benign
IGL03077:Prl3b1 APN 13 27245776 missense probably benign 0.00
Gabby UTSW 13 27247945 missense probably damaging 1.00
peaches UTSW 13 27242490 start codon destroyed probably null 1.00
Pits UTSW 13 27247974 critical splice donor site probably null
R0716:Prl3b1 UTSW 13 27243796 missense probably benign 0.02
R0758:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R0773:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R0774:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R0775:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1364:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1366:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1368:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1530:Prl3b1 UTSW 13 27243865 missense probably benign 0.00
R1884:Prl3b1 UTSW 13 27247903 missense possibly damaging 0.95
R1990:Prl3b1 UTSW 13 27245792 missense possibly damaging 0.94
R1991:Prl3b1 UTSW 13 27247912 missense possibly damaging 0.60
R2014:Prl3b1 UTSW 13 27247965 missense probably benign 0.00
R2885:Prl3b1 UTSW 13 27249522 missense probably damaging 1.00
R4259:Prl3b1 UTSW 13 27243906 splice site probably null
R4580:Prl3b1 UTSW 13 27249467 missense possibly damaging 0.93
R4913:Prl3b1 UTSW 13 27249477 missense probably damaging 0.99
R5897:Prl3b1 UTSW 13 27245875 missense probably benign 0.08
R6235:Prl3b1 UTSW 13 27247945 missense probably damaging 1.00
R6366:Prl3b1 UTSW 13 27243892 missense probably benign 0.00
R6597:Prl3b1 UTSW 13 27247974 critical splice donor site probably null
R7179:Prl3b1 UTSW 13 27243844 missense probably benign 0.05
R7312:Prl3b1 UTSW 13 27242490 start codon destroyed probably null 1.00
X0026:Prl3b1 UTSW 13 27247923 missense probably benign 0.21
Z1177:Prl3b1 UTSW 13 27243759 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GGACAGACAGTATAGCCTCTACAGTGT -3'
(R):5'- AGGGTTTGATGATTGCTCCATTGGAA -3'

Sequencing Primer
(F):5'- CAGTATAGCCTCTACAGTGTCATTTG -3'
(R):5'- ggaggaggtgagaggtgg -3'
Posted On2014-02-11