Incidental Mutation 'R1367:Exoc2'
ID 156088
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission 039432-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.954) question?
Stock # R1367 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 30882273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 473 (Y473*)
Ref Sequence ENSEMBL: ENSMUSP00000100010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
Predicted Effect probably null
Transcript: ENSMUST00000021785
AA Change: Y473*
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: Y473*

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102946
AA Change: Y473*
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: Y473*

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
R9731:Exoc2 UTSW 13 30877250 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGGGCTGGATAACTTGTGTGACTAC -3'
(R):5'- GCTGAGAGAAGTGCCTCACCAAAAG -3'

Sequencing Primer
(F):5'- tctcatttagcccttagaaccac -3'
(R):5'- TGCCTCACCAAAAGGAAGAG -3'
Posted On 2014-02-11