Incidental Mutation 'R1367:Abcc1'
ID156093
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14443386 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 676 (V676A)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
Predicted Effect probably damaging
Transcript: ENSMUST00000100167
AA Change: V676A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: V676A

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147759
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Meta Mutation Damage Score 0.6303 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTCAGATAGGCGAATACCCTC -3'
(R):5'- CGGCAGTACATCTAAGCATTCACGG -3'

Sequencing Primer
(F):5'- GATAGGCGAATACCCTCTATCAGTTC -3'
(R):5'- TGACTGAGCAGCTATCACATGTC -3'
Posted On2014-02-11