Incidental Mutation 'R1367:Olfr191'
ID156095
Institutional Source Beutler Lab
Gene Symbol Olfr191
Ensembl Gene ENSMUSG00000094539
Gene Nameolfactory receptor 191
SynonymsGA_x54KRFPKG5P-55314632-55313703, MOR183-5P
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59082829-59089822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59086343 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000150473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078517] [ENSMUST00000205471] [ENSMUST00000215647]
Predicted Effect probably benign
Transcript: ENSMUST00000078517
AA Change: I47F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077604
Gene: ENSMUSG00000094539
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-47 PFAM
Pfam:7tm_1 41 290 6.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205471
AA Change: I47F
Predicted Effect probably benign
Transcript: ENSMUST00000215647
AA Change: I47F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Olfr191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr191 APN 16 59086393 missense possibly damaging 0.86
IGL01553:Olfr191 APN 16 59086322 missense probably benign 0.35
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R1631:Olfr191 UTSW 16 59086045 missense probably benign
R1660:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R2166:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2167:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2168:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2191:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R3836:Olfr191 UTSW 16 59086223 missense possibly damaging 0.61
R4999:Olfr191 UTSW 16 59086402 missense probably damaging 1.00
R5386:Olfr191 UTSW 16 59085890 missense probably benign
R5589:Olfr191 UTSW 16 59085971 missense probably benign 0.03
R5590:Olfr191 UTSW 16 59085997 missense probably benign 0.06
R5609:Olfr191 UTSW 16 59086076 missense possibly damaging 0.96
R5965:Olfr191 UTSW 16 59086303 missense probably damaging 1.00
R5989:Olfr191 UTSW 16 59086334 missense probably benign 0.00
R6049:Olfr191 UTSW 16 59086146 nonsense probably null
R6058:Olfr191 UTSW 16 59085910 missense probably damaging 0.99
R6058:Olfr191 UTSW 16 59086429 missense probably benign
R6250:Olfr191 UTSW 16 59085832 missense probably damaging 1.00
R6319:Olfr191 UTSW 16 59086021 missense probably benign 0.08
R6473:Olfr191 UTSW 16 59086043 missense probably benign 0.09
R6524:Olfr191 UTSW 16 59086277 missense possibly damaging 0.76
R6748:Olfr191 UTSW 16 59085890 missense probably benign
R6874:Olfr191 UTSW 16 59085949 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTGAAGACCTGAATTGAGCCAGAG -3'
(R):5'- CATTTCAGAGACAGCCAGTGAGGAC -3'

Sequencing Primer
(F):5'- CGTGGTTGCACTCACTACAAATG -3'
(R):5'- GACATGGAAACGGACAACAC -3'
Posted On2014-02-11