Incidental Mutation 'R1367:H2-M1'
ID156097
Institutional Source Beutler Lab
Gene Symbol H2-M1
Ensembl Gene ENSMUSG00000037334
Gene Namehistocompatibility 2, M region locus 1
SynonymsH-2M1, Mb1
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36670008-36672219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36671167 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 181 (S181P)
Ref Sequence ENSEMBL: ENSMUSP00000040435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041662]
Predicted Effect probably benign
Transcript: ENSMUST00000041662
AA Change: S181P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040435
Gene: ENSMUSG00000037334
AA Change: S181P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 202 7.1e-47 PFAM
IGc1 221 292 3.53e-22 SMART
transmembrane domain 310 332 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in H2-M1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:H2-M1 APN 17 36671307 missense possibly damaging 0.92
IGL01671:H2-M1 APN 17 36670438 missense probably damaging 1.00
IGL01870:H2-M1 APN 17 36670063 missense probably benign 0.38
IGL02032:H2-M1 APN 17 36671876 missense probably damaging 1.00
IGL02383:H2-M1 APN 17 36670249 missense unknown
IGL02417:H2-M1 APN 17 36672134 missense possibly damaging 0.95
IGL02700:H2-M1 APN 17 36671269 missense possibly damaging 0.93
R0193:H2-M1 UTSW 17 36671332 missense probably benign 0.34
R0715:H2-M1 UTSW 17 36670228 splice site probably benign
R1271:H2-M1 UTSW 17 36671245 missense probably benign 0.33
R2120:H2-M1 UTSW 17 36670037 missense possibly damaging 0.95
R4854:H2-M1 UTSW 17 36670058 missense probably benign 0.03
R4899:H2-M1 UTSW 17 36671220 missense probably benign 0.09
R4963:H2-M1 UTSW 17 36671738 missense probably benign
R5243:H2-M1 UTSW 17 36671301 missense possibly damaging 0.73
R6199:H2-M1 UTSW 17 36671167 missense probably benign 0.00
R6276:H2-M1 UTSW 17 36671710 missense possibly damaging 0.79
R6395:H2-M1 UTSW 17 36671809 missense probably benign 0.39
R6818:H2-M1 UTSW 17 36670435 missense probably damaging 1.00
R7913:H2-M1 UTSW 17 36670237 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACAGACTGAACTGAGCTGGGAG -3'
(R):5'- TGCCAAGTCATGCACAGACGCTAC -3'

Sequencing Primer
(F):5'- TCCCTTTGATGCAAGACTGAG -3'
(R):5'- TGCACAGACGCTACTTCAGTC -3'
Posted On2014-02-11