Incidental Mutation 'R1329:Vil1'
ID156103
Institutional Source Beutler Lab
Gene Symbol Vil1
Ensembl Gene ENSMUSG00000026175
Gene Namevillin 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R1329 (G1)
Quality Score215
Status Not validated
Chromosome1
Chromosomal Location74409376-74435559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74427558 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 636 (I636V)
Ref Sequence ENSEMBL: ENSMUSP00000027366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027366]
Predicted Effect probably benign
Transcript: ENSMUST00000027366
AA Change: I636V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: I636V

DomainStartEndE-ValueType
GEL 17 114 2.93e-29 SMART
GEL 135 229 1.33e-18 SMART
GEL 251 349 5.85e-29 SMART
GEL 398 495 1.44e-28 SMART
GEL 515 601 7.31e-30 SMART
GEL 620 714 1.36e-29 SMART
VHP 792 827 1.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159749
SMART Domains Protein: ENSMUSP00000123786
Gene: ENSMUSG00000026175

DomainStartEndE-ValueType
GEL 37 131 1.33e-18 SMART
GEL 153 248 6.68e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163018
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)          

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Vil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Vil1 APN 1 74423875 missense probably damaging 1.00
IGL00703:Vil1 APN 1 74423960 missense possibly damaging 0.61
IGL01011:Vil1 APN 1 74434887 unclassified probably null
IGL01314:Vil1 APN 1 74428238 missense probably damaging 1.00
IGL01772:Vil1 APN 1 74415119 missense probably benign
IGL02378:Vil1 APN 1 74430691 splice site probably null
IGL02517:Vil1 APN 1 74426692 missense probably benign 0.43
IGL02955:Vil1 APN 1 74418523 missense probably benign 0.10
IGL03036:Vil1 APN 1 74419612 missense probably damaging 1.00
PIT4362001:Vil1 UTSW 1 74421383 missense probably damaging 1.00
R0104:Vil1 UTSW 1 74418366 missense probably benign 0.44
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0496:Vil1 UTSW 1 74421340 missense possibly damaging 0.88
R1824:Vil1 UTSW 1 74418447 missense probably benign 0.00
R1916:Vil1 UTSW 1 74418525 missense probably benign
R2188:Vil1 UTSW 1 74427565 missense probably benign 0.22
R2216:Vil1 UTSW 1 74425679 missense probably benign 0.05
R3808:Vil1 UTSW 1 74427613 missense probably benign
R3939:Vil1 UTSW 1 74432415 missense probably benign 0.09
R4288:Vil1 UTSW 1 74418525 missense probably benign
R4648:Vil1 UTSW 1 74432298 missense probably benign
R4748:Vil1 UTSW 1 74421266 missense probably damaging 1.00
R5333:Vil1 UTSW 1 74432390 missense probably benign
R5429:Vil1 UTSW 1 74432331 missense probably benign 0.05
R5973:Vil1 UTSW 1 74416033 missense possibly damaging 0.93
R6007:Vil1 UTSW 1 74419867 missense probably damaging 1.00
R6247:Vil1 UTSW 1 74432339 missense probably benign
R6306:Vil1 UTSW 1 74421311 missense possibly damaging 0.90
R6989:Vil1 UTSW 1 74423954 missense probably damaging 0.99
R7112:Vil1 UTSW 1 74416002 missense probably damaging 1.00
R7320:Vil1 UTSW 1 74418444 missense probably damaging 1.00
R7481:Vil1 UTSW 1 74419899 missense probably damaging 1.00
R7553:Vil1 UTSW 1 74426732 critical splice donor site probably null
R7709:Vil1 UTSW 1 74426595 missense probably benign 0.39
R7791:Vil1 UTSW 1 74428136 missense probably damaging 1.00
Z1176:Vil1 UTSW 1 74428232 missense probably damaging 0.98
Z1177:Vil1 UTSW 1 74415132 missense probably damaging 1.00
Z1177:Vil1 UTSW 1 74421430 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCTCTCGGACGGAGAAACAAG -3'
(R):5'- TGCCACAAGAGCACAGTATGCC -3'

Sequencing Primer
(F):5'- AGCCAGCCAACTTCTGGATG -3'
(R):5'- GCACAGTATGCCTGACAATGTTC -3'
Posted On2014-02-11