Incidental Mutation 'R1329:Rin2'
ID 156107
Institutional Source Beutler Lab
Gene Symbol Rin2
Ensembl Gene ENSMUSG00000001768
Gene Name Ras and Rab interactor 2
Synonyms 2010003K16Rik, RASSF4, 4632403N06Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R1329 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 145613647-145729536 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 145702366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 354 (T354I)
Ref Sequence ENSEMBL: ENSMUSP00000105632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]
AlphaFold Q9D684
Predicted Effect probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

DomainStartEndE-ValueType
SH2 50 136 1.38e-3 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
Blast:SH2 540 576 2e-7 BLAST
VPS9 612 730 1.72e-68 SMART
RA 751 842 3.35e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

DomainStartEndE-ValueType
SH2 95 181 1.38e-3 SMART
low complexity region 220 232 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
low complexity region 438 456 N/A INTRINSIC
Blast:SH2 585 621 2e-7 BLAST
VPS9 657 775 1.72e-68 SMART
RA 796 887 3.35e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145874
Predicted Effect probably benign
Transcript: ENSMUST00000147976
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C T 4: 152,314,241 (GRCm39) Q188* probably null Het
Ano5 T C 7: 51,196,533 (GRCm39) Y141H probably benign Het
Atg101 G A 15: 101,188,171 (GRCm39) G92D probably null Het
Brwd1 A G 16: 95,804,434 (GRCm39) I1912T probably benign Het
Cad G T 5: 31,216,926 (GRCm39) G263W probably damaging Het
Clstn2 T C 9: 97,340,227 (GRCm39) E715G probably damaging Het
Cracd A G 5: 76,805,779 (GRCm39) probably benign Het
Dbp C T 7: 45,357,752 (GRCm39) P70S probably damaging Het
Fem1al T A 11: 29,773,553 (GRCm39) N635Y probably benign Het
Gpr61 T A 3: 108,057,830 (GRCm39) H277L probably benign Het
Gsdma3 G T 11: 98,523,218 (GRCm39) V203F probably damaging Het
Ifih1 G C 2: 62,447,831 (GRCm39) probably null Het
Myo1e T A 9: 70,246,020 (GRCm39) C404S possibly damaging Het
Myrfl A G 10: 116,613,247 (GRCm39) probably null Het
Nfat5 T G 8: 108,095,659 (GRCm39) M1300R probably benign Het
Nfrkb C T 9: 31,325,943 (GRCm39) P1129S possibly damaging Het
Nubp2 A T 17: 25,102,838 (GRCm39) N208K possibly damaging Het
Or8g20 A G 9: 39,395,740 (GRCm39) S270P probably damaging Het
Ovch2 T C 7: 107,384,653 (GRCm39) D488G probably damaging Het
Rfx6 A T 10: 51,569,833 (GRCm39) Y202F probably damaging Het
Usp4 T A 9: 108,249,765 (GRCm39) V431E probably damaging Het
Vil1 A G 1: 74,466,717 (GRCm39) I636V probably benign Het
Vmn2r116 A G 17: 23,606,162 (GRCm39) N358S possibly damaging Het
Wdr47 T A 3: 108,534,615 (GRCm39) N511K probably benign Het
Wdr5 T A 2: 27,421,683 (GRCm39) F222I probably damaging Het
Other mutations in Rin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Rin2 APN 2 145,701,926 (GRCm39) splice site probably benign
IGL03222:Rin2 APN 2 145,702,115 (GRCm39) nonsense probably null
IGL03371:Rin2 APN 2 145,727,846 (GRCm39) utr 3 prime probably benign
IGL03411:Rin2 APN 2 145,702,864 (GRCm39) missense probably damaging 0.99
D4043:Rin2 UTSW 2 145,664,283 (GRCm39) missense possibly damaging 0.61
R0025:Rin2 UTSW 2 145,720,752 (GRCm39) splice site probably benign
R0110:Rin2 UTSW 2 145,702,953 (GRCm39) missense probably benign
R0144:Rin2 UTSW 2 145,718,559 (GRCm39) missense probably damaging 0.96
R0510:Rin2 UTSW 2 145,702,953 (GRCm39) missense probably benign
R1326:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1327:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1328:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1330:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R1544:Rin2 UTSW 2 145,700,366 (GRCm39) missense probably damaging 1.00
R1658:Rin2 UTSW 2 145,718,376 (GRCm39) missense probably benign 0.04
R1832:Rin2 UTSW 2 145,703,091 (GRCm39) missense possibly damaging 0.48
R1986:Rin2 UTSW 2 145,720,860 (GRCm39) missense probably damaging 1.00
R2137:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2167:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2170:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2260:Rin2 UTSW 2 145,720,824 (GRCm39) missense probably damaging 0.97
R2312:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R2884:Rin2 UTSW 2 145,702,911 (GRCm39) missense probably benign 0.07
R3155:Rin2 UTSW 2 145,702,771 (GRCm39) missense probably benign 0.17
R3771:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3772:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3773:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3822:Rin2 UTSW 2 145,664,550 (GRCm39) missense probably benign 0.02
R3824:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3825:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3885:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3893:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3939:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R3940:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4012:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4019:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4058:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4214:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4231:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4232:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4236:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4372:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4410:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4415:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4471:Rin2 UTSW 2 145,702,366 (GRCm39) missense probably benign 0.00
R4490:Rin2 UTSW 2 145,664,194 (GRCm39) missense possibly damaging 0.66
R4597:Rin2 UTSW 2 145,702,825 (GRCm39) missense probably benign 0.01
R5099:Rin2 UTSW 2 145,720,821 (GRCm39) missense probably damaging 1.00
R5268:Rin2 UTSW 2 145,686,680 (GRCm39) missense probably benign
R5493:Rin2 UTSW 2 145,702,629 (GRCm39) missense probably damaging 1.00
R5622:Rin2 UTSW 2 145,702,299 (GRCm39) missense probably benign 0.07
R5947:Rin2 UTSW 2 145,686,863 (GRCm39) intron probably benign
R6280:Rin2 UTSW 2 145,702,939 (GRCm39) missense probably damaging 1.00
R7009:Rin2 UTSW 2 145,725,395 (GRCm39) missense probably damaging 1.00
R7531:Rin2 UTSW 2 145,700,419 (GRCm39) missense probably benign
R7824:Rin2 UTSW 2 145,703,037 (GRCm39) missense probably benign 0.00
R8065:Rin2 UTSW 2 145,702,977 (GRCm39) missense probably damaging 0.99
R8067:Rin2 UTSW 2 145,702,977 (GRCm39) missense probably damaging 0.99
R8144:Rin2 UTSW 2 145,664,225 (GRCm39) missense probably benign
R8510:Rin2 UTSW 2 145,727,611 (GRCm39) missense probably damaging 1.00
R8853:Rin2 UTSW 2 145,718,475 (GRCm39) missense possibly damaging 0.68
R8880:Rin2 UTSW 2 145,690,772 (GRCm39) missense probably damaging 1.00
R9224:Rin2 UTSW 2 145,720,822 (GRCm39) nonsense probably null
R9325:Rin2 UTSW 2 145,727,819 (GRCm39) missense probably benign 0.15
R9417:Rin2 UTSW 2 145,686,713 (GRCm39) missense probably benign 0.02
R9555:Rin2 UTSW 2 145,718,415 (GRCm39) nonsense probably null
R9631:Rin2 UTSW 2 145,718,437 (GRCm39) missense probably damaging 1.00
R9667:Rin2 UTSW 2 145,702,202 (GRCm39) missense possibly damaging 0.89
R9691:Rin2 UTSW 2 145,690,764 (GRCm39) missense probably damaging 0.97
R9727:Rin2 UTSW 2 145,702,506 (GRCm39) missense possibly damaging 0.94
R9780:Rin2 UTSW 2 145,718,551 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTCAGCTCTGCCTTATAAATGG -3'
(R):5'- AAGTGGAAAGGCTCATGTCGCTC -3'

Sequencing Primer
(F):5'- CTCTGCCTTATAAATGGAGTGC -3'
(R):5'- GGCTGTGATTCAGAGCCG -3'
Posted On 2014-02-11