Incidental Mutation 'R1329:Gpr61'
ID156108
Institutional Source Beutler Lab
Gene Symbol Gpr61
Ensembl Gene ENSMUSG00000046793
Gene NameG protein-coupled receptor 61
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108148321-108154882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108150514 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 277 (H277L)
Ref Sequence ENSEMBL: ENSMUSP00000055557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000001] [ENSMUST00000062028] [ENSMUST00000116284]
Predicted Effect probably benign
Transcript: ENSMUST00000000001
SMART Domains Protein: ENSMUSP00000000001
Gene: ENSMUSG00000000001

DomainStartEndE-ValueType
G_alpha 13 353 4.43e-218 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062028
AA Change: H277L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000055557
Gene: ENSMUSG00000046793
AA Change: H277L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:7tm_1 59 341 1.7e-36 PFAM
low complexity region 394 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116284
AA Change: H277L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111988
Gene: ENSMUSG00000046793
AA Change: H277L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:7tm_1 59 341 4.2e-41 PFAM
low complexity region 394 406 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family. G protein-coupled receptors contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. The protein encoded by this gene is most closely related to biogenic amine receptors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Gpr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Gpr61 APN 3 108151198 missense probably damaging 1.00
IGL02354:Gpr61 APN 3 108150218 missense probably damaging 1.00
IGL02878:Gpr61 APN 3 108150028 missense probably damaging 0.97
R1061:Gpr61 UTSW 3 108150307 missense probably damaging 1.00
R1295:Gpr61 UTSW 3 108150481 missense possibly damaging 0.78
R1296:Gpr61 UTSW 3 108150481 missense possibly damaging 0.78
R1718:Gpr61 UTSW 3 108150380 missense possibly damaging 0.81
R1840:Gpr61 UTSW 3 108150481 missense possibly damaging 0.78
R2139:Gpr61 UTSW 3 108150761 missense probably damaging 1.00
R5016:Gpr61 UTSW 3 108150667 missense possibly damaging 0.63
R7042:Gpr61 UTSW 3 108151331 missense possibly damaging 0.93
R7689:Gpr61 UTSW 3 108150650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTTTGCTAAGCTCGCCCC -3'
(R):5'- CAATGGAGCCATAGTGCCTACTGC -3'

Sequencing Primer
(F):5'- ATCTGACGGTTGAGACATCC -3'
(R):5'- GTGCCTACTGCCAGCTTTTTG -3'
Posted On2014-02-11