Incidental Mutation 'R1329:Dbp'
ID156113
Institutional Source Beutler Lab
Gene Symbol Dbp
Ensembl Gene ENSMUSG00000059824
Gene NameD site albumin promoter binding protein
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45705088-45710203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45708328 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 70 (P70S)
Ref Sequence ENSEMBL: ENSMUSP00000147790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003360] [ENSMUST00000072836] [ENSMUST00000080885] [ENSMUST00000107737] [ENSMUST00000210060] [ENSMUST00000211340] [ENSMUST00000211357] [ENSMUST00000211513]
Predicted Effect probably benign
Transcript: ENSMUST00000003360
SMART Domains Protein: ENSMUSP00000003360
Gene: ENSMUSG00000003273

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Carb_anhydrase 35 303 1.1e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072836
SMART Domains Protein: ENSMUSP00000072615
Gene: ENSMUSG00000057342

DomainStartEndE-ValueType
SCOP:d1epfa2 63 87 1e-2 SMART
DAGKc 147 284 4.49e-5 SMART
low complexity region 369 376 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
PDB:3VZB|C 468 609 4e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000080885
AA Change: P207S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079693
Gene: ENSMUSG00000059824
AA Change: P207S

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 98 N/A INTRINSIC
low complexity region 127 171 N/A INTRINSIC
BRLZ 253 317 5.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107737
SMART Domains Protein: ENSMUSP00000103366
Gene: ENSMUSG00000057342

DomainStartEndE-ValueType
SCOP:d1epfa2 63 87 1e-2 SMART
DAGKc 147 284 4.49e-5 SMART
low complexity region 369 376 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
PDB:3VZB|C 468 609 4e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209796
Predicted Effect probably benign
Transcript: ENSMUST00000210027
Predicted Effect probably benign
Transcript: ENSMUST00000210060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211259
Predicted Effect probably benign
Transcript: ENSMUST00000211340
Predicted Effect possibly damaging
Transcript: ENSMUST00000211357
AA Change: P107S

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000211513
AA Change: P70S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211748
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Par bZIP transcription factor family and binds to specific sequences in the promoters of several genes, such as albumin, Cyp2a4, and Cyp2a5. The encoded protein can bind DNA as a homo- or heterodimer and is involved in the regulation of some circadian rhythym genes. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null mutation display a shortened circadian period and decreased acvtivity during the dark phase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Dbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1436:Dbp UTSW 7 45708455 missense probably damaging 1.00
R1907:Dbp UTSW 7 45708320 missense possibly damaging 0.74
R2025:Dbp UTSW 7 45708276 missense probably benign 0.16
R2027:Dbp UTSW 7 45708276 missense probably benign 0.16
R6753:Dbp UTSW 7 45708404 missense probably damaging 0.99
R7453:Dbp UTSW 7 45705703 missense probably benign 0.04
R7719:Dbp UTSW 7 45709750 missense probably damaging 1.00
R7814:Dbp UTSW 7 45706990 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTGCCTTCCGGTGGCAAAGC -3'
(R):5'- ATTGGCAGCAGAGCCTCTTGGAAC -3'

Sequencing Primer
(F):5'- CACAGGGTTTATGCCTGACAG -3'
(R):5'- CATGAGCTAGGCTATGCCTACAG -3'
Posted On2014-02-11