Incidental Mutation 'R1329:Ovch2'
ID156115
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Nameovochymase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107781544-107801208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107785446 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 488 (D488G)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: D488G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: D488G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208448
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107796568 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107793994 missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107789094 missense probably benign 0.17
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107794370 missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107789088 critical splice donor site probably null
R7841:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7908:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
R7924:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7989:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCAATGGCCTTTCACAGATGGTTC -3'
(R):5'- CCCTGCACGCAAGCTGTATTTGATAG -3'

Sequencing Primer
(F):5'- GGCCTTTCACAGATGGTTCAAATAG -3'
(R):5'- TCAAGAGTTTTGAGGGCCTATC -3'
Posted On2014-02-11