Incidental Mutation 'R1329:Gsdma3'
ID156125
Institutional Source Beutler Lab
Gene Symbol Gsdma3
Ensembl Gene ENSMUSG00000064224
Gene Namegasdermin A3
SynonymsGsdm1l, Bsk, Rim3, Dfl, Rco2, Gsdm3, Fgn
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98626360-98638226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98632392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 203 (V203F)
Ref Sequence ENSEMBL: ENSMUSP00000103132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073295] [ENSMUST00000107508]
Predicted Effect probably damaging
Transcript: ENSMUST00000073295
AA Change: V203F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073022
Gene: ENSMUSG00000064224
AA Change: V203F

DomainStartEndE-ValueType
Pfam:Gasdermin 3 430 1.4e-132 PFAM
low complexity region 438 452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107508
AA Change: V203F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103132
Gene: ENSMUSG00000064224
AA Change: V203F

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 9.5e-134 PFAM
low complexity region 429 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations of this gene affect normal development of the hair follicle, resulting in abnormal coats. Some alleles are associated with corneal opacity and/or microphthalmia. For one allele, high rates of mutation are observed in the MHC that appear to be associated with intra-MHC recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Gsdma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Gsdma3 APN 11 98637572 missense probably damaging 0.97
IGL01375:Gsdma3 APN 11 98629941 critical splice donor site probably null
IGL01721:Gsdma3 APN 11 98637956 missense possibly damaging 0.95
IGL02179:Gsdma3 APN 11 98635271 missense possibly damaging 0.88
IGL02612:Gsdma3 APN 11 98635881 missense probably damaging 0.99
IGL02866:Gsdma3 APN 11 98629759 missense possibly damaging 0.88
IGL02970:Gsdma3 APN 11 98632993 missense probably benign 0.01
Michelin UTSW 11 98637573 missense probably damaging 0.98
Mr_magoo UTSW 11 98635919 missense probably damaging 1.00
PIT4486001:Gsdma3 UTSW 11 98638054 missense unknown
R0408:Gsdma3 UTSW 11 98635338 missense probably benign 0.41
R0539:Gsdma3 UTSW 11 98635919 missense probably damaging 1.00
R0675:Gsdma3 UTSW 11 98631191 missense probably benign 0.03
R1759:Gsdma3 UTSW 11 98635245 missense possibly damaging 0.93
R1812:Gsdma3 UTSW 11 98632393 missense probably damaging 0.99
R1838:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R1839:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R2287:Gsdma3 UTSW 11 98638004 missense possibly damaging 0.83
R4883:Gsdma3 UTSW 11 98629567 critical splice donor site probably null
R6767:Gsdma3 UTSW 11 98637884 missense possibly damaging 0.93
R7053:Gsdma3 UTSW 11 98629795 missense possibly damaging 0.75
R7733:Gsdma3 UTSW 11 98635215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGGCCATAAGTTCAGAGCACAG -3'
(R):5'- AAGGCATCAGGAGGTCATCACCAG -3'

Sequencing Primer
(F):5'- GACAACTAGAGATCCTTCTGAAGGC -3'
(R):5'- AATTCAGGTCCTTCATCGAGAGC -3'
Posted On2014-02-11