Incidental Mutation 'R1330:Dolk'
ID156134
Institutional Source Beutler Lab
Gene Symbol Dolk
Ensembl Gene ENSMUSG00000075419
Gene Namedolichol kinase
SynonymsTmem15
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30284231-30286334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30285100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 311 (V311E)
Ref Sequence ENSEMBL: ENSMUSP00000097792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447] [ENSMUST00000091132] [ENSMUST00000100219] [ENSMUST00000113634] [ENSMUST00000113643] [ENSMUST00000113645] [ENSMUST00000127689] [ENSMUST00000133877] [ENSMUST00000138254] [ENSMUST00000138666] [ENSMUST00000139454] [ENSMUST00000139719] [ENSMUST00000148969] [ENSMUST00000150695] [ENSMUST00000154647]
Predicted Effect probably benign
Transcript: ENSMUST00000064447
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091132
SMART Domains Protein: ENSMUSP00000088663
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 32 279 2.7e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100219
AA Change: V311E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097792
Gene: ENSMUSG00000075419
AA Change: V311E

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 108 130 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
transmembrane domain 252 274 N/A INTRINSIC
transmembrane domain 294 313 N/A INTRINSIC
transmembrane domain 333 350 N/A INTRINSIC
transmembrane domain 355 377 N/A INTRINSIC
transmembrane domain 398 418 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 476 493 N/A INTRINSIC
low complexity region 522 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113634
SMART Domains Protein: ENSMUSP00000109264
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 128 1.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113643
SMART Domains Protein: ENSMUSP00000109273
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 238 9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113645
SMART Domains Protein: ENSMUSP00000109275
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127689
SMART Domains Protein: ENSMUSP00000119543
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 150 7.5e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Predicted Effect probably benign
Transcript: ENSMUST00000133877
SMART Domains Protein: ENSMUSP00000117643
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 8 249 9.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138254
SMART Domains Protein: ENSMUSP00000116062
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 157 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138666
SMART Domains Protein: ENSMUSP00000122398
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 118 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139454
SMART Domains Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139719
SMART Domains Protein: ENSMUSP00000116450
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 217 4.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143119
SMART Domains Protein: ENSMUSP00000125607
Gene: ENSMUSG00000098794

DomainStartEndE-ValueType
PDB:3OBZ|A 1 31 4e-9 PDB
Pfam:Nup188 47 126 2.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147204
SMART Domains Protein: ENSMUSP00000122095
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
PDB:3OBZ|A 2 42 4e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000148969
SMART Domains Protein: ENSMUSP00000121742
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 115 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150695
SMART Domains Protein: ENSMUSP00000121995
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 107 1.1e-16 PFAM
Pfam:PhyH 104 212 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154647
SMART Domains Protein: ENSMUSP00000121371
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156023
Meta Mutation Damage Score 0.8503 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man, which is an essential glycosyl carrier lipid for C- and O-mannosylation, N- and O-linked glycosylation of proteins, and for the biosynthesis of glycosyl phosphatidylinositol anchors in endoplasmic reticulum. Mutations in this gene are associated with dolichol kinase deficiency.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozyogus for a targeted null mutation exhibit lethality. Heterozygous mice show decreased depressive-like responses, hyperalgesia, and altered sensitivity to novelty-induced stress/anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Dolk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Dolk APN 2 30284731 missense probably damaging 1.00
IGL01529:Dolk APN 2 30285737 missense probably benign
IGL01893:Dolk APN 2 30285914 missense probably benign 0.03
IGL02138:Dolk APN 2 30285979 missense probably benign 0.08
IGL02392:Dolk APN 2 30285728 missense probably benign 0.34
IGL03247:Dolk APN 2 30285511 missense probably damaging 1.00
PIT4131001:Dolk UTSW 2 30285574 missense probably benign 0.01
R0243:Dolk UTSW 2 30286019 missense probably benign
R1564:Dolk UTSW 2 30285621 missense probably damaging 0.99
R2314:Dolk UTSW 2 30285485 missense probably damaging 0.96
R4299:Dolk UTSW 2 30285188 missense probably damaging 1.00
R5526:Dolk UTSW 2 30285808 missense probably damaging 1.00
R7520:Dolk UTSW 2 30284543 missense probably benign
R7890:Dolk UTSW 2 30284714 missense probably damaging 1.00
R7896:Dolk UTSW 2 30285949 missense possibly damaging 0.58
R7973:Dolk UTSW 2 30284714 missense probably damaging 1.00
R7979:Dolk UTSW 2 30285949 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTCGGAAATAGCGCACATACTCCAG -3'
(R):5'- GGGTGGCATTAGCTTCGTCCTTAAC -3'

Sequencing Primer
(F):5'- CTCCAGGAAGATGAAGACTGCC -3'
(R):5'- GCTCTCTGACTGAAAGCCAG -3'
Posted On2014-02-11