Incidental Mutation 'R1330:Wdr47'
ID156137
Institutional Source Beutler Lab
Gene Symbol Wdr47
Ensembl Gene ENSMUSG00000040389
Gene NameWD repeat domain 47
Synonyms1810073M12Rik
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108591279-108645719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108629753 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 586 (S586P)
Ref Sequence ENSEMBL: ENSMUSP00000057482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051145]
Predicted Effect probably benign
Transcript: ENSMUST00000051145
AA Change: S586P

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057482
Gene: ENSMUSG00000040389
AA Change: S586P

DomainStartEndE-ValueType
LisH 10 42 8.87e-4 SMART
CTLH 45 102 1.93e-13 SMART
low complexity region 137 146 N/A INTRINSIC
low complexity region 226 254 N/A INTRINSIC
coiled coil region 414 455 N/A INTRINSIC
low complexity region 506 523 N/A INTRINSIC
WD40 597 635 7e-4 SMART
WD40 648 690 5.18e-7 SMART
WD40 698 742 2.28e2 SMART
WD40 745 783 9.38e-5 SMART
WD40 790 829 1.31e-3 SMART
WD40 832 871 1.28e-6 SMART
WD40 878 917 7.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197398
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Wdr47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Wdr47 APN 3 108618734 missense probably benign 0.04
IGL01730:Wdr47 APN 3 108611396 missense probably damaging 1.00
IGL01821:Wdr47 APN 3 108627204 missense probably damaging 1.00
IGL03367:Wdr47 APN 3 108629773 splice site probably benign
R0025:Wdr47 UTSW 3 108637991 missense probably damaging 1.00
R0217:Wdr47 UTSW 3 108637020 missense probably damaging 0.96
R0733:Wdr47 UTSW 3 108618623 missense probably damaging 1.00
R1329:Wdr47 UTSW 3 108627299 missense probably benign 0.14
R1894:Wdr47 UTSW 3 108623376 missense possibly damaging 0.56
R2004:Wdr47 UTSW 3 108627442 nonsense probably null
R2040:Wdr47 UTSW 3 108623372 missense probably benign 0.01
R2242:Wdr47 UTSW 3 108619115 missense probably damaging 1.00
R3795:Wdr47 UTSW 3 108624737 critical splice donor site probably null
R5026:Wdr47 UTSW 3 108618522 nonsense probably null
R5732:Wdr47 UTSW 3 108633156 nonsense probably null
R5823:Wdr47 UTSW 3 108643085 missense probably damaging 1.00
R5838:Wdr47 UTSW 3 108624736 critical splice donor site probably null
R5890:Wdr47 UTSW 3 108610012 missense probably damaging 1.00
R5896:Wdr47 UTSW 3 108619006 missense probably damaging 1.00
R5898:Wdr47 UTSW 3 108637885 splice site probably null
R6778:Wdr47 UTSW 3 108633096 missense probably benign 0.16
R7019:Wdr47 UTSW 3 108614355 nonsense probably null
R7051:Wdr47 UTSW 3 108618524 missense probably damaging 1.00
R7535:Wdr47 UTSW 3 108629711 missense probably benign 0.01
R7642:Wdr47 UTSW 3 108643164 missense possibly damaging 0.47
R7709:Wdr47 UTSW 3 108618521 missense probably damaging 1.00
R8048:Wdr47 UTSW 3 108618968 missense probably damaging 0.99
X0062:Wdr47 UTSW 3 108619058 missense probably benign 0.01
Z1177:Wdr47 UTSW 3 108619114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCGAGGAAAAGTTCTCCCTCC -3'
(R):5'- GCTCTTCACGGTTGCCAGAATTGTC -3'

Sequencing Primer
(F):5'- GCCCTTAAGTGGCTCCATATAGTAG -3'
(R):5'- gtagtggcacacacctttaatc -3'
Posted On2014-02-11