Incidental Mutation 'R1330:Adgrf3'
ID 156140
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms PGR23, LOC381628, Gpr113
MMRRC Submission 039395-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1330 (G1)
Quality Score 189
Status Validated
Chromosome 5
Chromosomal Location 30398429-30410720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30400093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 83 (T83S)
Ref Sequence ENSEMBL: ENSMUSP00000120958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably benign
Transcript: ENSMUST00000088117
AA Change: T967S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: T967S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
AA Change: T83S

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642
AA Change: T83S

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,097,018 (GRCm39) T98A probably benign Het
Adgre4 T A 17: 56,085,814 (GRCm39) C38S probably benign Het
Arhgef40 T C 14: 52,227,613 (GRCm39) V453A probably benign Het
Art4 A T 6: 136,831,339 (GRCm39) probably benign Het
Cdhr2 A G 13: 54,882,081 (GRCm39) K1177R possibly damaging Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Ddx6 T C 9: 44,539,070 (GRCm39) probably benign Het
Dolk A T 2: 30,175,112 (GRCm39) V311E probably damaging Het
Dstyk A G 1: 132,377,618 (GRCm39) N408S probably benign Het
Efcab3 A G 11: 104,637,116 (GRCm39) Y1049C possibly damaging Het
Eva1c A C 16: 90,701,284 (GRCm39) E318D probably damaging Het
Frem3 T A 8: 81,395,468 (GRCm39) W1832R probably damaging Het
Jup A T 11: 100,263,502 (GRCm39) I689N probably benign Het
Kcnh7 A G 2: 62,607,755 (GRCm39) S609P possibly damaging Het
Lrch4 G A 5: 137,636,051 (GRCm39) R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 (GRCm39) V586M probably benign Het
Ncstn C T 1: 171,899,092 (GRCm39) M346I probably damaging Het
Osbpl1a A G 18: 13,015,251 (GRCm39) probably null Het
Pcdh12 A G 18: 38,414,914 (GRCm39) V737A probably benign Het
Pds5b T A 5: 150,684,542 (GRCm39) M600K probably damaging Het
Rbm25 A G 12: 83,724,666 (GRCm39) D805G probably damaging Het
Rfx7 C T 9: 72,524,547 (GRCm39) T579I probably benign Het
Rhod C A 19: 4,476,182 (GRCm39) A190S probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc22a2 A C 17: 12,805,699 (GRCm39) D150A possibly damaging Het
Spink11 A G 18: 44,329,195 (GRCm39) I17T unknown Het
Tas1r2 A G 4: 139,396,640 (GRCm39) I660V probably benign Het
Utp20 G A 10: 88,637,051 (GRCm39) P720L probably damaging Het
Vmn1r1 A T 1: 181,985,572 (GRCm39) L31H probably damaging Het
Vmn2r23 T C 6: 123,718,963 (GRCm39) L772P probably damaging Het
Wap T C 11: 6,586,818 (GRCm39) T94A unknown Het
Wdr47 T C 3: 108,537,069 (GRCm39) S586P probably benign Het
Zfp318 A G 17: 46,724,684 (GRCm39) Y2229C possibly damaging Het
Zfp429 T C 13: 67,544,262 (GRCm39) probably null Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30,401,827 (GRCm39) missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30,401,292 (GRCm39) missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30,410,607 (GRCm39) splice site probably benign
R0042:Adgrf3 UTSW 5 30,402,426 (GRCm39) missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30,401,379 (GRCm39) missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30,400,078 (GRCm39) missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30,401,874 (GRCm39) missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30,404,532 (GRCm39) missense probably damaging 0.99
R1468:Adgrf3 UTSW 5 30,407,227 (GRCm39) splice site probably benign
R1695:Adgrf3 UTSW 5 30,408,553 (GRCm39) missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30,402,549 (GRCm39) missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30,404,211 (GRCm39) missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30,407,304 (GRCm39) missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30,404,489 (GRCm39) missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30,401,436 (GRCm39) missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30,401,992 (GRCm39) missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30,402,358 (GRCm39) missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30,401,821 (GRCm39) missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30,405,432 (GRCm39) unclassified probably benign
R4043:Adgrf3 UTSW 5 30,409,360 (GRCm39) missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30,402,367 (GRCm39) nonsense probably null
R4575:Adgrf3 UTSW 5 30,407,255 (GRCm39) missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30,402,615 (GRCm39) critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30,403,442 (GRCm39) missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30,405,476 (GRCm39) missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30,404,146 (GRCm39) missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30,402,304 (GRCm39) missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30,410,637 (GRCm39) missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30,403,360 (GRCm39) critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30,401,265 (GRCm39) missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30,402,531 (GRCm39) missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30,402,312 (GRCm39) missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30,401,522 (GRCm39) missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30,408,601 (GRCm39) missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30,401,385 (GRCm39) missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30,402,519 (GRCm39) missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30,409,378 (GRCm39) nonsense probably null
R7250:Adgrf3 UTSW 5 30,400,680 (GRCm39) missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30,403,495 (GRCm39) missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30,407,245 (GRCm39) missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30,402,204 (GRCm39) missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30,404,510 (GRCm39) missense probably damaging 1.00
R8281:Adgrf3 UTSW 5 30,402,301 (GRCm39) missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30,403,579 (GRCm39) unclassified probably benign
R8857:Adgrf3 UTSW 5 30,402,065 (GRCm39) nonsense probably null
R8926:Adgrf3 UTSW 5 30,405,446 (GRCm39) missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30,400,071 (GRCm39) missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30,401,957 (GRCm39) missense probably benign 0.01
R9522:Adgrf3 UTSW 5 30,404,482 (GRCm39) missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30,404,118 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTGGATTTAACCCGCAGCAGC -3'
(R):5'- TCACAGACAAGAAGGTGAGTGCCC -3'

Sequencing Primer
(F):5'- ACGACTTGGTTTGGAGGCC -3'
(R):5'- GGAGTCCTTTTTACAGCAAGCAG -3'
Posted On 2014-02-11