Mutagenetix > Incidental Mutation

Incidental Mutation 'R1330:Vmn2r23'

156143

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

039395-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R1330 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123742004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 772 (L772P)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158091

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: L772P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: L772P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.5%
3x: 97.2%
10x: 92.6%
20x: 82.0%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	T	C	7: 42,447,594	T98A	probably benign	Het
Adgre4	T	A	17: 55,778,814	C38S	probably benign	Het
Adgrf3	T	A	5: 30,195,095	T83S	probably benign	Het
Arhgef40	T	C	14: 51,990,156	V453A	probably benign	Het
Art4	A	T	6: 136,854,341		probably benign	Het
Cdhr2	A	G	13: 54,734,268	K1177R	possibly damaging	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Ddx6	T	C	9: 44,627,773		probably benign	Het
Dolk	A	T	2: 30,285,100	V311E	probably damaging	Het
Dstyk	A	G	1: 132,449,880	N408S	probably benign	Het
Eva1c	A	C	16: 90,904,396	E318D	probably damaging	Het
Frem3	T	A	8: 80,668,839	W1832R	probably damaging	Het
Gm11639	A	G	11: 104,746,290	Y1049C	possibly damaging	Het
Jup	A	T	11: 100,372,676	I689N	probably benign	Het
Kcnh7	A	G	2: 62,777,411	S609P	possibly damaging	Het
Lrch4	G	A	5: 137,637,789	R368Q	probably damaging	Het
Ncbp1	G	A	4: 46,167,354	V586M	probably benign	Het
Ncstn	C	T	1: 172,071,525	M346I	probably damaging	Het
Osbpl1a	A	G	18: 12,882,194		probably null	Het
Pcdh12	A	G	18: 38,281,861	V737A	probably benign	Het
Pds5b	T	A	5: 150,761,077	M600K	probably damaging	Het
Rbm25	A	G	12: 83,677,892	D805G	probably damaging	Het
Rfx7	C	T	9: 72,617,265	T579I	probably benign	Het
Rhod	C	A	19: 4,426,154	A190S	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Slc22a2	A	C	17: 12,586,812	D150A	possibly damaging	Het
Spink11	A	G	18: 44,196,128	I17T	unknown	Het
Tas1r2	A	G	4: 139,669,329	I660V	probably benign	Het
Utp20	G	A	10: 88,801,189	P720L	probably damaging	Het
Vmn1r1	A	T	1: 182,158,007	L31H	probably damaging	Het
Wap	T	C	11: 6,636,818	T94A	unknown	Het
Wdr47	T	C	3: 108,629,753	S586P	probably benign	Het
Zfp318	A	G	17: 46,413,758	Y2229C	possibly damaging	Het
Zfp429	T	C	13: 67,396,143		probably null	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGGCCTTCAAGTCCATCAAACC -3'
(R):5'- AGGATTGCAGAGTCAGATGCCATTG -3'

Sequencing Primer
(F):5'- GTGGATAGTGACTCGACTCTCAATC -3'
(R):5'- TGGTCACCTGACCTCAGTAG -3'

Posted On

2014-02-11