Incidental Mutation 'R1330:Art4'
ID156144
Institutional Source Beutler Lab
Gene Symbol Art4
Ensembl Gene ENSMUSG00000030217
Gene NameADP-ribosyltransferase 4
SynonymsDO, 4432404K01Rik, DOK1
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136848451-136857733 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 136854341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032341]
Predicted Effect probably benign
Transcript: ENSMUST00000032341
SMART Domains Protein: ENSMUSP00000032341
Gene: ENSMUSG00000030217

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 34 256 8.7e-51 PFAM
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. Antigens of the Dombrock blood group system are located on the gene product, which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane. Allelic variants, some of which lead to adverse transfusion reactions, are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Art4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Art4 APN 6 136854495 missense probably damaging 0.99
IGL00952:Art4 APN 6 136854820 missense possibly damaging 0.67
R4591:Art4 UTSW 6 136854757 missense probably damaging 1.00
R6114:Art4 UTSW 6 136857213 missense unknown
R6265:Art4 UTSW 6 136854888 missense probably damaging 0.96
R7176:Art4 UTSW 6 136857168 missense probably benign 0.41
R7201:Art4 UTSW 6 136854549 missense probably benign 0.00
R7466:Art4 UTSW 6 136854850 missense probably damaging 1.00
R7514:Art4 UTSW 6 136854741 missense probably benign 0.15
R7567:Art4 UTSW 6 136854430 missense possibly damaging 0.83
Z1177:Art4 UTSW 6 136849583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCCATCATTACTGGGGACAGG -3'
(R):5'- GCTGCTGAGGAAAGACAGCTCTAC -3'

Sequencing Primer
(F):5'- GACAGGTTTCCCTGTTTTCAAC -3'
(R):5'- TGCCTCCCTGCTAAAGGAAG -3'
Posted On2014-02-11