Incidental Mutation 'R1330:Rfx7'
ID156148
Institutional Source Beutler Lab
Gene Symbol Rfx7
Ensembl Gene ENSMUSG00000037674
Gene Nameregulatory factor X, 7
Synonyms9930116O05Rik, D130086K05Rik, 2510005N23Rik, Rfxdc2
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72532240-72622937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72617265 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 579 (T579I)
Ref Sequence ENSEMBL: ENSMUSP00000127192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093820] [ENSMUST00000163401] [ENSMUST00000183372] [ENSMUST00000184015]
Predicted Effect probably benign
Transcript: ENSMUST00000093820
AA Change: T579I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091338
Gene: ENSMUSG00000037674
AA Change: T579I

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 101 185 3.1e-39 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163401
AA Change: T579I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127192
Gene: ENSMUSG00000037674
AA Change: T579I

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 105 183 2.9e-33 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183372
SMART Domains Protein: ENSMUSP00000139195
Gene: ENSMUSG00000037674

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183601
Predicted Effect probably benign
Transcript: ENSMUST00000184015
SMART Domains Protein: ENSMUSP00000138957
Gene: ENSMUSG00000037674

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185013
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RFX7 is a member of the regulatory factor X (RFX) family of transcription factors (see RFX1, MIM 600006) (Aftab et al., 2008 [PubMed 18673564]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Rfx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rfx7 APN 9 72607690 missense probably damaging 1.00
IGL00323:Rfx7 APN 9 72617420 missense probably damaging 0.97
IGL00920:Rfx7 APN 9 72593356 missense probably damaging 1.00
IGL01317:Rfx7 APN 9 72618536 missense probably damaging 0.98
IGL01405:Rfx7 APN 9 72610344 missense probably benign 0.02
IGL01585:Rfx7 APN 9 72617061 missense probably benign 0.41
IGL02118:Rfx7 APN 9 72617204 missense probably benign
IGL02205:Rfx7 APN 9 72607650 missense probably damaging 1.00
IGL02608:Rfx7 APN 9 72617294 missense probably benign 0.00
IGL02629:Rfx7 APN 9 72619259 missense probably damaging 0.96
IGL02963:Rfx7 APN 9 72617616 missense probably benign 0.00
IGL03026:Rfx7 APN 9 72619685 missense probably damaging 1.00
IGL03033:Rfx7 APN 9 72532989 splice site probably benign
IGL03212:Rfx7 APN 9 72619161 missense probably benign 0.06
IGL03221:Rfx7 APN 9 72618806 missense probably damaging 0.99
PIT4431001:Rfx7 UTSW 9 72617971 missense probably benign
R0365:Rfx7 UTSW 9 72619836 missense probably benign 0.15
R0449:Rfx7 UTSW 9 72610304 critical splice acceptor site probably null
R0464:Rfx7 UTSW 9 72618204 missense probably damaging 1.00
R0746:Rfx7 UTSW 9 72619106 missense probably benign 0.00
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1263:Rfx7 UTSW 9 72577047 missense possibly damaging 0.79
R1277:Rfx7 UTSW 9 72593312 missense probably benign 0.32
R1371:Rfx7 UTSW 9 72619575 missense probably damaging 1.00
R1605:Rfx7 UTSW 9 72611789 missense probably damaging 1.00
R1802:Rfx7 UTSW 9 72619637 missense possibly damaging 0.50
R1903:Rfx7 UTSW 9 72616811 missense probably damaging 1.00
R2018:Rfx7 UTSW 9 72617685 missense probably benign 0.01
R2050:Rfx7 UTSW 9 72617466 missense probably benign 0.01
R2190:Rfx7 UTSW 9 72617919 missense probably benign 0.00
R2208:Rfx7 UTSW 9 72617964 missense probably benign 0.00
R2921:Rfx7 UTSW 9 72617664 missense possibly damaging 0.63
R3978:Rfx7 UTSW 9 72615111 missense possibly damaging 0.80
R4231:Rfx7 UTSW 9 72619390 missense possibly damaging 0.77
R4243:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4244:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4245:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4261:Rfx7 UTSW 9 72616643 missense probably damaging 1.00
R4844:Rfx7 UTSW 9 72593242 nonsense probably null
R4902:Rfx7 UTSW 9 72617291 missense probably benign 0.05
R5432:Rfx7 UTSW 9 72593302 missense probably benign 0.35
R5627:Rfx7 UTSW 9 72532784 start gained probably benign
R5900:Rfx7 UTSW 9 72617256 missense probably benign
R5991:Rfx7 UTSW 9 72619538 missense possibly damaging 0.54
R6273:Rfx7 UTSW 9 72616997 missense possibly damaging 0.47
R6306:Rfx7 UTSW 9 72616955 missense possibly damaging 0.63
R6324:Rfx7 UTSW 9 72618414 missense probably damaging 1.00
R6437:Rfx7 UTSW 9 72618486 missense possibly damaging 0.66
R6860:Rfx7 UTSW 9 72616944 missense probably damaging 1.00
R6998:Rfx7 UTSW 9 72618505 missense probably damaging 1.00
R7255:Rfx7 UTSW 9 72619828 missense possibly damaging 0.77
R7336:Rfx7 UTSW 9 72593357 missense probably damaging 1.00
R7501:Rfx7 UTSW 9 72616772 missense probably benign
R7857:Rfx7 UTSW 9 72593323 missense possibly damaging 0.89
R7940:Rfx7 UTSW 9 72593323 missense possibly damaging 0.89
Z1177:Rfx7 UTSW 9 72615244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGTGCTACTGGAACAACAGAG -3'
(R):5'- AGCAGACAGTCGTTTCCTTGGAC -3'

Sequencing Primer
(F):5'- CCTCAGATCAAGAATGGTTCTGTC -3'
(R):5'- AGGGTCTTTATTTACTGAGTCACC -3'
Posted On2014-02-11