Incidental Mutation 'R1330:Gm11639'
ID156152
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104746290 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1049 (Y1049C)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
Predicted Effect probably benign
Transcript: ENSMUST00000148007
AA Change: Y997C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: Y997C

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000212287
AA Change: Y1049C

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7682:Gm11639 UTSW 11 104964348 intron probably null
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7923:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7929:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7962:Gm11639 UTSW 11 104720636 small deletion probably benign
R7976:Gm11639 UTSW 11 104979360 missense unknown
R7980:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R8031:Gm11639 UTSW 11 104881469 missense possibly damaging 0.49
R8041:Gm11639 UTSW 11 104919479 missense unknown
R8054:Gm11639 UTSW 11 104730400 missense probably benign 0.07
R8056:Gm11639 UTSW 11 104909070 missense probably damaging 0.98
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense probably benign 0.29
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense probably benign 0.03
Z1177:Gm11639 UTSW 11 104924019 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTGAAGTAGGCTCTGAACAAATG -3'
(R):5'- GCTTCCAATAGCATGACTCAGTTTCCC -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- AGCATGACTCAGTTTCCCATTTTAG -3'
Posted On2014-02-11