Incidental Mutation 'R1330:Cdhr2'
ID156154
Institutional Source Beutler Lab
Gene Symbol Cdhr2
Ensembl Gene ENSMUSG00000034918
Gene Namecadherin-related family member 2
SynonymsLOC268663, Pcdh24
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1330 (G1)
Quality Score186
Status Validated
Chromosome13
Chromosomal Location54701461-54736662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54734268 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1177 (K1177R)
Ref Sequence ENSEMBL: ENSMUSP00000043596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145] [ENSMUST00000099506] [ENSMUST00000135343]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037145
AA Change: K1177R

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918
AA Change: K1177R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099506
SMART Domains Protein: ENSMUSP00000097106
Gene: ENSMUSG00000069227

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 790 929 4.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135343
SMART Domains Protein: ENSMUSP00000115539
Gene: ENSMUSG00000069227

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 787 932 2.6e-49 PFAM
Meta Mutation Damage Score 0.1646 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin family, which represents a subset of the larger cadherin superfamily. The members of the protocadherin family encode non-classical cadherins that function as calcium-dependent cell-cell adhesion molecules. This protocadherin represents a new candidate for tumor suppression. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Cdhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cdhr2 APN 13 54718299 missense probably damaging 1.00
IGL00596:Cdhr2 APN 13 54720997 missense probably damaging 0.97
IGL00840:Cdhr2 APN 13 54720152 missense probably damaging 0.96
IGL00956:Cdhr2 APN 13 54718343 missense probably damaging 1.00
IGL01101:Cdhr2 APN 13 54718135 splice site probably benign
IGL01150:Cdhr2 APN 13 54731118 missense probably benign
IGL01412:Cdhr2 APN 13 54725894 missense probably damaging 1.00
IGL01515:Cdhr2 APN 13 54718238 missense probably benign 0.17
IGL02005:Cdhr2 APN 13 54719763 missense probably benign 0.00
IGL02187:Cdhr2 APN 13 54733710 missense possibly damaging 0.86
IGL02312:Cdhr2 APN 13 54717888 missense probably null 0.97
IGL02877:Cdhr2 APN 13 54734737 missense probably benign 0.39
IGL03072:Cdhr2 APN 13 54726661 missense probably benign 0.00
IGL03263:Cdhr2 APN 13 54718113 missense possibly damaging 0.75
FR4449:Cdhr2 UTSW 13 54725924 small insertion probably benign
PIT4494001:Cdhr2 UTSW 13 54718442 critical splice acceptor site probably null
PIT4498001:Cdhr2 UTSW 13 54718239 missense possibly damaging 0.75
R0041:Cdhr2 UTSW 13 54726838 missense probably damaging 1.00
R0149:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0329:Cdhr2 UTSW 13 54734801 unclassified probably benign
R0361:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0365:Cdhr2 UTSW 13 54718292 missense probably benign 0.00
R0598:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R0774:Cdhr2 UTSW 13 54717855 missense probably damaging 1.00
R1458:Cdhr2 UTSW 13 54717872 missense probably damaging 0.99
R1659:Cdhr2 UTSW 13 54719761 missense probably damaging 1.00
R1698:Cdhr2 UTSW 13 54719581 missense probably benign 0.00
R2061:Cdhr2 UTSW 13 54720818 missense probably damaging 1.00
R2098:Cdhr2 UTSW 13 54715644 missense probably benign 0.15
R2135:Cdhr2 UTSW 13 54720947 missense probably damaging 1.00
R2365:Cdhr2 UTSW 13 54718088 missense probably benign 0.01
R3693:Cdhr2 UTSW 13 54726416 missense probably damaging 1.00
R3968:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R3970:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R4001:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4003:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4030:Cdhr2 UTSW 13 54717861 missense probably damaging 1.00
R4088:Cdhr2 UTSW 13 54717888 missense probably null 0.97
R4256:Cdhr2 UTSW 13 54714005 missense probably damaging 0.99
R4322:Cdhr2 UTSW 13 54733721 missense probably benign 0.00
R4396:Cdhr2 UTSW 13 54715665 missense probably damaging 0.99
R4591:Cdhr2 UTSW 13 54715684 missense probably benign 0.18
R4726:Cdhr2 UTSW 13 54718539 missense probably damaging 0.99
R5370:Cdhr2 UTSW 13 54720887 missense probably damaging 1.00
R5396:Cdhr2 UTSW 13 54736456 missense probably benign
R5447:Cdhr2 UTSW 13 54733250 missense probably damaging 1.00
R5654:Cdhr2 UTSW 13 54736536 missense probably benign
R5727:Cdhr2 UTSW 13 54724308 missense possibly damaging 0.95
R5771:Cdhr2 UTSW 13 54726695 missense probably damaging 0.99
R5924:Cdhr2 UTSW 13 54726683 missense probably benign 0.01
R5928:Cdhr2 UTSW 13 54734019 missense probably benign 0.01
R6246:Cdhr2 UTSW 13 54719710 missense probably damaging 1.00
R6351:Cdhr2 UTSW 13 54726776 missense probably benign 0.16
R6358:Cdhr2 UTSW 13 54736546 missense probably damaging 0.99
R6433:Cdhr2 UTSW 13 54718512 missense probably damaging 0.97
R7044:Cdhr2 UTSW 13 54733321 nonsense probably null
R7341:Cdhr2 UTSW 13 54719492 missense probably damaging 0.99
R7462:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R7488:Cdhr2 UTSW 13 54717915 missense probably benign 0.28
R7763:Cdhr2 UTSW 13 54717692 missense probably damaging 1.00
R7771:Cdhr2 UTSW 13 54718275 missense probably damaging 1.00
R8050:Cdhr2 UTSW 13 54734222 missense probably damaging 0.96
R8069:Cdhr2 UTSW 13 54731070 missense probably damaging 1.00
R8070:Cdhr2 UTSW 13 54719793 missense probably benign 0.13
Z1177:Cdhr2 UTSW 13 54715671 missense probably damaging 1.00
Z1177:Cdhr2 UTSW 13 54718564 missense probably damaging 1.00
Z1177:Cdhr2 UTSW 13 54726408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGAGCTGAATATGTGAGTGGGG -3'
(R):5'- AAGCTACCGCCTGTGCAAGAAG -3'

Sequencing Primer
(F):5'- CTCTGTGGCAGGATGATCCG -3'
(R):5'- CCTGTGCAAGAAGTGGCAAC -3'
Posted On2014-02-11