Incidental Mutation 'R1330:Ddx41'
ID156155
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Synonyms2900024F02Rik
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55530410-55536658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55534480 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 205 (R205W)
Ref Sequence ENSEMBL: ENSMUSP00000153348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021956
AA Change: R194W

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: R194W

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021957
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224686
Predicted Effect possibly damaging
Transcript: ENSMUST00000224765
AA Change: R205W

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225783
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55531399 missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55532467 missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55532357 missense probably benign 0.04
R0081:Ddx41 UTSW 13 55535380 missense possibly damaging 0.58
R0097:Ddx41 UTSW 13 55535878 splice site probably benign
R0412:Ddx41 UTSW 13 55530608 missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55533006 missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55531299 splice site probably benign
R1812:Ddx41 UTSW 13 55535954 missense probably benign 0.03
R2011:Ddx41 UTSW 13 55534093 splice site probably null
R2224:Ddx41 UTSW 13 55531401 missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55534300 missense probably benign 0.03
R2983:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3032:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3916:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55531270 missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55533144 missense probably damaging 1.00
R4569:Ddx41 UTSW 13 55536021 missense possibly damaging 0.88
R4823:Ddx41 UTSW 13 55532055 missense probably benign 0.02
R4837:Ddx41 UTSW 13 55531648 missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55535291 missense probably benign 0.00
R5642:Ddx41 UTSW 13 55535895 missense possibly damaging 0.86
R5926:Ddx41 UTSW 13 55534299 missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55532061 missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R7254:Ddx41 UTSW 13 55533956 nonsense probably null
R7640:Ddx41 UTSW 13 55534239 missense possibly damaging 0.81
R7803:Ddx41 UTSW 13 55531921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATACCAGTGTCTTGCCTGACCC -3'
(R):5'- TCTGCTTCAACAGAGCTTCCATGAG -3'

Sequencing Primer
(F):5'- AGGCAATGCCGATCATGTCC -3'
(R):5'- TTCCATGAGAACTTAGGCCCAG -3'
Posted On2014-02-11