Incidental Mutation 'R1330:Eva1c'
ID156158
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Nameeva-1 homolog C (C. elegans)
Synonyms
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90826719-90905109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90904396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 318 (E318D)
Ref Sequence ENSEMBL: ENSMUSP00000155994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000231280] [ENSMUST00000231964]
Predicted Effect probably damaging
Transcript: ENSMUST00000037539
AA Change: E413D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903
AA Change: E413D

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099543
AA Change: E365D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903
AA Change: E365D

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099548
AA Change: E419D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903
AA Change: E419D

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231280
AA Change: E306D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231964
AA Change: E318D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232665
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90904347 missense probably damaging 1.00
IGL02061:Eva1c APN 16 90866275 nonsense probably null
R0067:Eva1c UTSW 16 90866417 missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90866417 missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90876098 missense probably benign 0.03
R1765:Eva1c UTSW 16 90904247 missense probably benign 0.01
R1824:Eva1c UTSW 16 90866443 missense probably benign 0.01
R1880:Eva1c UTSW 16 90897415 missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90831325 missense probably benign 0.12
R4072:Eva1c UTSW 16 90904131 missense probably damaging 1.00
R4076:Eva1c UTSW 16 90904131 missense probably damaging 1.00
R4622:Eva1c UTSW 16 90897455 critical splice donor site probably null
R4760:Eva1c UTSW 16 90904250 missense probably benign 0.37
R4767:Eva1c UTSW 16 90904347 missense probably damaging 1.00
R5024:Eva1c UTSW 16 90876193 critical splice donor site probably null
R5304:Eva1c UTSW 16 90869663 missense probably damaging 1.00
R5559:Eva1c UTSW 16 90904251 missense probably benign 0.06
R6605:Eva1c UTSW 16 90866348 missense probably damaging 1.00
R7222:Eva1c UTSW 16 90904184 small deletion probably benign
R7409:Eva1c UTSW 16 90869656 missense probably damaging 1.00
R7449:Eva1c UTSW 16 90876193 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCCTGGTCCACTGTGATGAAAAC -3'
(R):5'- CTTCACCCATCTCGGATGACAAGAC -3'

Sequencing Primer
(F):5'- tcccaaattaactctttcacacc -3'
(R):5'- TCTCGGATGACAAGACAGATTCTC -3'
Posted On2014-02-11