Incidental Mutation 'R1330:Slc22a2'
ID156159
Institutional Source Beutler Lab
Gene Symbol Slc22a2
Ensembl Gene ENSMUSG00000040966
Gene Namesolute carrier family 22 (organic cation transporter), member 2
SynonymsOrct2, Oct2
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12584189-12628465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 12586812 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 150 (D150A)
Ref Sequence ENSEMBL: ENSMUSP00000041186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046959]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046959
AA Change: D150A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041186
Gene: ENSMUSG00000040966
AA Change: D150A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 80 528 7.6e-37 PFAM
Pfam:MFS_1 134 398 3.5e-21 PFAM
Meta Mutation Damage Score 0.4404 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Slc22a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc22a2 APN 17 12608418 missense possibly damaging 0.79
IGL00658:Slc22a2 APN 17 12615315 missense probably benign 0.37
IGL01073:Slc22a2 APN 17 12584349 missense probably benign 0.00
IGL01573:Slc22a2 APN 17 12605961 missense probably damaging 0.99
IGL02000:Slc22a2 APN 17 12584383 missense possibly damaging 0.77
IGL02943:Slc22a2 APN 17 12610061 missense probably damaging 1.00
IGL03301:Slc22a2 APN 17 12606039 missense probably damaging 1.00
R0492:Slc22a2 UTSW 17 12615272 missense probably benign 0.00
R0835:Slc22a2 UTSW 17 12612431 missense probably benign 0.01
R1432:Slc22a2 UTSW 17 12584308 missense possibly damaging 0.89
R1559:Slc22a2 UTSW 17 12584411 missense probably damaging 1.00
R1855:Slc22a2 UTSW 17 12586812 missense probably damaging 0.99
R1884:Slc22a2 UTSW 17 12614826 splice site probably benign
R2042:Slc22a2 UTSW 17 12599125 missense probably benign 0.01
R2197:Slc22a2 UTSW 17 12599062 missense probably damaging 1.00
R2255:Slc22a2 UTSW 17 12599175 missense probably damaging 1.00
R2271:Slc22a2 UTSW 17 12586805 missense probably benign
R4003:Slc22a2 UTSW 17 12612450 missense probably benign 0.01
R4021:Slc22a2 UTSW 17 12584489 missense probably damaging 1.00
R4093:Slc22a2 UTSW 17 12612394 missense probably damaging 1.00
R4404:Slc22a2 UTSW 17 12614764 missense probably damaging 1.00
R4419:Slc22a2 UTSW 17 12612586 nonsense probably null
R4564:Slc22a2 UTSW 17 12610056 missense probably benign 0.08
R4866:Slc22a2 UTSW 17 12584429 missense probably damaging 1.00
R4877:Slc22a2 UTSW 17 12614815 missense possibly damaging 0.53
R5224:Slc22a2 UTSW 17 12586832 missense probably damaging 0.97
R5668:Slc22a2 UTSW 17 12608409 missense probably benign
R6326:Slc22a2 UTSW 17 12612410 nonsense probably null
R7137:Slc22a2 UTSW 17 12584341 missense probably benign
R7211:Slc22a2 UTSW 17 12586883 critical splice donor site probably null
R7378:Slc22a2 UTSW 17 12612391 missense probably damaging 1.00
R7521:Slc22a2 UTSW 17 12586823 missense probably benign 0.14
R7524:Slc22a2 UTSW 17 12606057 missense possibly damaging 0.87
R7735:Slc22a2 UTSW 17 12610030 missense probably damaging 0.99
Z1088:Slc22a2 UTSW 17 12614776 missense probably benign 0.36
Z1176:Slc22a2 UTSW 17 12584625 missense possibly damaging 0.79
Z1177:Slc22a2 UTSW 17 12606010 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGAGCGGCTGGGTTATTGGCAC -3'
(R):5'- AAGCAACCACTTTTCAGGCGGG -3'

Sequencing Primer
(F):5'- GTTATTGGCACTCAGTTCAAGAG -3'
(R):5'- GAGCAAGTGGGCTGTCG -3'
Posted On2014-02-11