Incidental Mutation 'R1330:Adgre4'
ID156161
Institutional Source Beutler Lab
Gene Symbol Adgre4
Ensembl Gene ENSMUSG00000032915
Gene Nameadhesion G protein-coupled receptor E4
SynonymsGpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55749984-55853662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55778814 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 38 (C38S)
Ref Sequence ENSEMBL: ENSMUSP00000025004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025004]
Predicted Effect probably benign
Transcript: ENSMUST00000025004
AA Change: C38S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: C38S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:EGF_like 38 76 2e-10 BLAST
Pfam:EGF_CA 77 117 3.6e-9 PFAM
GPS 288 338 4.03e-12 SMART
Pfam:7tm_2 343 588 5.7e-57 PFAM
low complexity region 613 628 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Spink11 A G 18: 44,196,128 I17T unknown Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Adgre4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adgre4 APN 17 55791915 splice site probably benign
IGL00228:Adgre4 APN 17 55802135 missense probably damaging 1.00
IGL00572:Adgre4 APN 17 55820648 missense probably benign 0.00
IGL01404:Adgre4 APN 17 55797639 missense possibly damaging 0.63
IGL01420:Adgre4 APN 17 55799785 splice site probably benign
IGL01501:Adgre4 APN 17 55802002 splice site probably benign
IGL01510:Adgre4 APN 17 55818760 critical splice donor site probably null
IGL01554:Adgre4 APN 17 55817090 missense probably damaging 1.00
IGL01607:Adgre4 APN 17 55794748 splice site probably benign
IGL01767:Adgre4 APN 17 55797740 missense probably benign 0.19
IGL02253:Adgre4 APN 17 55760573 missense probably benign 0.01
IGL02358:Adgre4 APN 17 55843209 missense probably benign 0.15
IGL02466:Adgre4 APN 17 55814188 missense probably benign 0.42
IGL03057:Adgre4 APN 17 55799602 splice site probably benign
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0111:Adgre4 UTSW 17 55817073 missense possibly damaging 0.92
R0311:Adgre4 UTSW 17 55802010 missense probably benign 0.36
R0366:Adgre4 UTSW 17 55792001 nonsense probably null
R0415:Adgre4 UTSW 17 55852288 missense probably benign 0.03
R0465:Adgre4 UTSW 17 55785137 splice site probably benign
R0619:Adgre4 UTSW 17 55820679 missense possibly damaging 0.52
R0685:Adgre4 UTSW 17 55792035 missense probably benign 0.05
R0724:Adgre4 UTSW 17 55852281 missense probably benign 0.00
R0835:Adgre4 UTSW 17 55799637 missense probably damaging 1.00
R1452:Adgre4 UTSW 17 55784996 missense probably benign 0.35
R1960:Adgre4 UTSW 17 55791497 missense probably benign
R1961:Adgre4 UTSW 17 55791497 missense probably benign
R2046:Adgre4 UTSW 17 55778847 missense possibly damaging 0.82
R2421:Adgre4 UTSW 17 55778872 missense probably benign 0.10
R2570:Adgre4 UTSW 17 55778878 missense possibly damaging 0.54
R3162:Adgre4 UTSW 17 55802218 splice site probably benign
R4222:Adgre4 UTSW 17 55785121 missense probably damaging 1.00
R4526:Adgre4 UTSW 17 55785016 nonsense probably null
R4631:Adgre4 UTSW 17 55814305 missense probably null 1.00
R4689:Adgre4 UTSW 17 55802096 missense probably damaging 1.00
R4701:Adgre4 UTSW 17 55784971 missense probably damaging 1.00
R4792:Adgre4 UTSW 17 55791491 missense probably benign 0.00
R5205:Adgre4 UTSW 17 55794727 nonsense probably null
R5210:Adgre4 UTSW 17 55785029 missense probably damaging 0.97
R5358:Adgre4 UTSW 17 55818758 missense probably benign 0.00
R5873:Adgre4 UTSW 17 55852282 missense probably benign 0.13
R6025:Adgre4 UTSW 17 55792013 missense probably benign 0.00
R6257:Adgre4 UTSW 17 55802133 missense possibly damaging 0.87
R6426:Adgre4 UTSW 17 55802196 missense probably benign 0.18
R6440:Adgre4 UTSW 17 55794744 critical splice donor site probably null
R6484:Adgre4 UTSW 17 55802036 missense possibly damaging 0.52
R6680:Adgre4 UTSW 17 55791959 missense probably benign 0.09
R7086:Adgre4 UTSW 17 55820649 missense probably benign 0.00
R7442:Adgre4 UTSW 17 55852340 missense probably benign 0.04
R7467:Adgre4 UTSW 17 55791952 missense probably benign 0.00
R7875:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R7958:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R8007:Adgre4 UTSW 17 55814233 missense probably damaging 0.99
S24628:Adgre4 UTSW 17 55852288 missense probably benign 0.03
X0010:Adgre4 UTSW 17 55814308 missense probably damaging 1.00
Z1177:Adgre4 UTSW 17 55814152 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGAAAAGGAACTATAAGGTCTCCCA -3'
(R):5'- TCTACTTGGCACAAGGAAGGGACATT -3'

Sequencing Primer
(F):5'- AGGTCTCCCAATTGAAATTTGAC -3'
(R):5'- tccataccttctaatccttcctaaac -3'
Posted On2014-02-11