Incidental Mutation 'R1330:Spink11'
ID156164
Institutional Source Beutler Lab
Gene Symbol Spink11
Ensembl Gene ENSMUSG00000073573
Gene Nameserine peptidase inhibitor, Kazal type 11
Synonyms9230112K01Rik
MMRRC Submission 039395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1330 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44190045-44196177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44196128 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 17 (I17T)
Ref Sequence ENSEMBL: ENSMUSP00000095194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097587]
Predicted Effect unknown
Transcript: ENSMUST00000097587
AA Change: I17T
SMART Domains Protein: ENSMUSP00000095194
Gene: ENSMUSG00000073573
AA Change: I17T

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
KAZAL 63 111 7.29e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185266
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.2%
  • 10x: 92.6%
  • 20x: 82.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik T C 7: 42,447,594 T98A probably benign Het
Adgre4 T A 17: 55,778,814 C38S probably benign Het
Adgrf3 T A 5: 30,195,095 T83S probably benign Het
Arhgef40 T C 14: 51,990,156 V453A probably benign Het
Art4 A T 6: 136,854,341 probably benign Het
Cdhr2 A G 13: 54,734,268 K1177R possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Ddx6 T C 9: 44,627,773 probably benign Het
Dolk A T 2: 30,285,100 V311E probably damaging Het
Dstyk A G 1: 132,449,880 N408S probably benign Het
Eva1c A C 16: 90,904,396 E318D probably damaging Het
Frem3 T A 8: 80,668,839 W1832R probably damaging Het
Gm11639 A G 11: 104,746,290 Y1049C possibly damaging Het
Jup A T 11: 100,372,676 I689N probably benign Het
Kcnh7 A G 2: 62,777,411 S609P possibly damaging Het
Lrch4 G A 5: 137,637,789 R368Q probably damaging Het
Ncbp1 G A 4: 46,167,354 V586M probably benign Het
Ncstn C T 1: 172,071,525 M346I probably damaging Het
Osbpl1a A G 18: 12,882,194 probably null Het
Pcdh12 A G 18: 38,281,861 V737A probably benign Het
Pds5b T A 5: 150,761,077 M600K probably damaging Het
Rbm25 A G 12: 83,677,892 D805G probably damaging Het
Rfx7 C T 9: 72,617,265 T579I probably benign Het
Rhod C A 19: 4,426,154 A190S probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc22a2 A C 17: 12,586,812 D150A possibly damaging Het
Tas1r2 A G 4: 139,669,329 I660V probably benign Het
Utp20 G A 10: 88,801,189 P720L probably damaging Het
Vmn1r1 A T 1: 182,158,007 L31H probably damaging Het
Vmn2r23 T C 6: 123,742,004 L772P probably damaging Het
Wap T C 11: 6,636,818 T94A unknown Het
Wdr47 T C 3: 108,629,753 S586P probably benign Het
Zfp318 A G 17: 46,413,758 Y2229C possibly damaging Het
Zfp429 T C 13: 67,396,143 probably null Het
Other mutations in Spink11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Spink11 APN 18 44192634 critical splice acceptor site probably null
R1973:Spink11 UTSW 18 44196138 missense unknown
R2136:Spink11 UTSW 18 44190487 missense probably benign 0.00
R2968:Spink11 UTSW 18 44195710 missense possibly damaging 0.53
R5363:Spink11 UTSW 18 44195686 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACACAATCTGAGCACGGAATGAC -3'
(R):5'- GCTGACCCAGTGAGAACAGAGAATACC -3'

Sequencing Primer
(F):5'- TTATCCAGGGGGCATCCAG -3'
(R):5'- AAGGGCTGAACGATCATGTG -3'
Posted On2014-02-11