Incidental Mutation 'R1331:Ccdc39'
ID156177
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Namecoiled-coil domain containing 39
Synonymsb2b2025.1Clo, b2b1735Clo, 4921507O14Rik, D3Ertd789e, b2b1304Clo
MMRRC Submission 039396-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R1331 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location33812362-33844310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33815485 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 731 (E731G)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000117915]
Predicted Effect probably benign
Transcript: ENSMUST00000029222
AA Change: E731G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: E731G

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099153
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117915
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200536
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,882,376 probably null Het
Acat1 T C 9: 53,584,883 D318G probably benign Het
Ahdc1 T C 4: 133,063,691 F748L probably benign Het
Alkbh8 T A 9: 3,347,916 probably null Het
Arhgef26 A G 3: 62,340,028 T178A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 V509A possibly damaging Het
Cenpf A G 1: 189,642,801 V2931A probably damaging Het
Cobl A T 11: 12,375,853 N207K probably damaging Het
Col14a1 T A 15: 55,410,188 W718R unknown Het
D430042O09Rik A G 7: 125,866,455 T1360A probably benign Het
Dnah7a A G 1: 53,468,669 I3081T probably damaging Het
Dync1h1 T C 12: 110,649,264 V2977A probably damaging Het
Ephb4 A G 5: 137,366,534 probably benign Het
Eri3 T C 4: 117,564,907 probably benign Het
Fbxo24 A G 5: 137,619,629 V291A probably damaging Het
Glra1 A C 11: 55,515,070 S282A probably benign Het
Gm7589 C A 9: 59,146,042 noncoding transcript Het
H6pd T C 4: 149,982,415 N505D probably benign Het
Hdlbp T A 1: 93,421,131 N566Y probably damaging Het
Hsp90aa1 C A 12: 110,692,820 K514N probably damaging Het
Impdh1 A T 6: 29,206,478 V120D probably damaging Het
Loxhd1 C T 18: 77,402,936 P1411S possibly damaging Het
Lpl A G 8: 68,896,629 E269G probably damaging Het
Map1a G T 2: 121,306,220 E2268* probably null Het
Mark1 T C 1: 184,928,048 E137G probably damaging Het
Mki67 A T 7: 135,698,276 S1676R possibly damaging Het
Mogat2 T C 7: 99,223,515 Y154C possibly damaging Het
Myo18a C G 11: 77,841,579 I859M probably benign Het
Myo7a A G 7: 98,107,008 V39A probably benign Het
Nedd4 T A 9: 72,677,386 I123N probably damaging Het
Obscn A G 11: 59,086,928 V1966A probably benign Het
Olfr853 T C 9: 19,537,546 N128S probably benign Het
Orc3 T G 4: 34,599,748 N77T probably benign Het
Penk A G 4: 4,134,287 M120T probably benign Het
Phf7 G A 14: 31,240,405 Q148* probably null Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pkhd1l1 C T 15: 44,589,597 R3973C probably damaging Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Ptprb A T 10: 116,367,532 T2070S probably damaging Het
Ralgapb T C 2: 158,430,533 F169S probably damaging Het
Rapgef5 G T 12: 117,721,349 A278S probably benign Het
Ripor2 G T 13: 24,677,841 E203* probably null Het
Setx T C 2: 29,179,686 L2501P probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc35b1 T A 11: 95,385,863 V56D probably damaging Het
Slc45a4 C T 15: 73,586,747 D326N probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat4 T A 1: 52,013,927 V89D probably benign Het
Tek T A 4: 94,739,706 probably benign Het
Tert T A 13: 73,648,354 F1068Y probably damaging Het
Trim33 T A 3: 103,310,354 I205K probably damaging Het
Vmn1r212 A T 13: 22,883,392 I257K probably benign Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33832568 missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33816958 unclassified probably benign
IGL02426:Ccdc39 APN 3 33825398 missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33825494 missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33830118 missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33837843 missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33819839 missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33844125 missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1370:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33821412 missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33839145 missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33819896 missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33815501 missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33821432 missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33836733 missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33841178 missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33815484 missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33837838 missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33814497 missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33825479 missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33837882 missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33826522 missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33819806 critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33813078 missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33839093 synonymous probably null
R5236:Ccdc39 UTSW 3 33830102 missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33825550 missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33816937 missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33826561 missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33841192 splice site probably null
R6375:Ccdc39 UTSW 3 33814367 missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33837959 missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33830093 missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33819868 missense probably damaging 1.00
R7183:Ccdc39 UTSW 3 33814471 missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33830105 missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33832676 missense possibly damaging 0.55
R7695:Ccdc39 UTSW 3 33814519 missense probably damaging 1.00
R7752:Ccdc39 UTSW 3 33832617 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CGTGAGATCACTGAGTGATGGTGAG -3'
(R):5'- TGACTCCGTCAAGTAGGTAGCAGC -3'

Sequencing Primer
(F):5'- TGCCTCTCAGCCATAGAATTGTAAC -3'
(R):5'- TCAAGTAGGTAGCAGCCATTAC -3'
Posted On2014-02-11