Incidental Mutation 'R1331:Arhgef26'
ID156178
Institutional Source Beutler Lab
Gene Symbol Arhgef26
Ensembl Gene ENSMUSG00000036885
Gene NameRho guanine nucleotide exchange factor (GEF) 26
Synonyms4631416L12Rik, 8430436L14Rik
MMRRC Submission 039396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1331 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location62338344-62462221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62340028 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 178 (T178A)
Ref Sequence ENSEMBL: ENSMUSP00000078281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079300]
Predicted Effect probably benign
Transcript: ENSMUST00000079300
AA Change: T178A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: T178A

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
RhoGEF 441 620 1e-45 SMART
PH 654 782 4.04e-9 SMART
SH3 790 847 3.82e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192267
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,882,376 probably null Het
Acat1 T C 9: 53,584,883 D318G probably benign Het
Ahdc1 T C 4: 133,063,691 F748L probably benign Het
Alkbh8 T A 9: 3,347,916 probably null Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 V509A possibly damaging Het
Ccdc39 T C 3: 33,815,485 E731G probably benign Het
Cenpf A G 1: 189,642,801 V2931A probably damaging Het
Cobl A T 11: 12,375,853 N207K probably damaging Het
Col14a1 T A 15: 55,410,188 W718R unknown Het
D430042O09Rik A G 7: 125,866,455 T1360A probably benign Het
Dnah7a A G 1: 53,468,669 I3081T probably damaging Het
Dync1h1 T C 12: 110,649,264 V2977A probably damaging Het
Ephb4 A G 5: 137,366,534 probably benign Het
Eri3 T C 4: 117,564,907 probably benign Het
Fbxo24 A G 5: 137,619,629 V291A probably damaging Het
Glra1 A C 11: 55,515,070 S282A probably benign Het
Gm7589 C A 9: 59,146,042 noncoding transcript Het
H6pd T C 4: 149,982,415 N505D probably benign Het
Hdlbp T A 1: 93,421,131 N566Y probably damaging Het
Hsp90aa1 C A 12: 110,692,820 K514N probably damaging Het
Impdh1 A T 6: 29,206,478 V120D probably damaging Het
Loxhd1 C T 18: 77,402,936 P1411S possibly damaging Het
Lpl A G 8: 68,896,629 E269G probably damaging Het
Map1a G T 2: 121,306,220 E2268* probably null Het
Mark1 T C 1: 184,928,048 E137G probably damaging Het
Mki67 A T 7: 135,698,276 S1676R possibly damaging Het
Mogat2 T C 7: 99,223,515 Y154C possibly damaging Het
Myo18a C G 11: 77,841,579 I859M probably benign Het
Myo7a A G 7: 98,107,008 V39A probably benign Het
Nedd4 T A 9: 72,677,386 I123N probably damaging Het
Obscn A G 11: 59,086,928 V1966A probably benign Het
Olfr853 T C 9: 19,537,546 N128S probably benign Het
Orc3 T G 4: 34,599,748 N77T probably benign Het
Penk A G 4: 4,134,287 M120T probably benign Het
Phf7 G A 14: 31,240,405 Q148* probably null Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pkhd1l1 C T 15: 44,589,597 R3973C probably damaging Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Ptprb A T 10: 116,367,532 T2070S probably damaging Het
Ralgapb T C 2: 158,430,533 F169S probably damaging Het
Rapgef5 G T 12: 117,721,349 A278S probably benign Het
Ripor2 G T 13: 24,677,841 E203* probably null Het
Setx T C 2: 29,179,686 L2501P probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc35b1 T A 11: 95,385,863 V56D probably damaging Het
Slc45a4 C T 15: 73,586,747 D326N probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat4 T A 1: 52,013,927 V89D probably benign Het
Tek T A 4: 94,739,706 probably benign Het
Tert T A 13: 73,648,354 F1068Y probably damaging Het
Trim33 T A 3: 103,310,354 I205K probably damaging Het
Vmn1r212 A T 13: 22,883,392 I257K probably benign Het
Other mutations in Arhgef26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Arhgef26 APN 3 62340383 missense probably benign
IGL01060:Arhgef26 APN 3 62340121 missense probably benign 0.44
IGL01942:Arhgef26 APN 3 62340094 missense probably benign 0.03
IGL02085:Arhgef26 APN 3 62459724 intron probably benign
IGL02172:Arhgef26 APN 3 62459676 missense probably benign 0.03
IGL03017:Arhgef26 APN 3 62448281 missense possibly damaging 0.46
IGL03101:Arhgef26 APN 3 62419661 missense possibly damaging 0.95
IGL03296:Arhgef26 APN 3 62423505 missense probably damaging 1.00
IGL03401:Arhgef26 APN 3 62423532 missense possibly damaging 0.95
R0138:Arhgef26 UTSW 3 62448259 missense probably benign 0.06
R0140:Arhgef26 UTSW 3 62448245 missense probably benign 0.02
R0152:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0157:Arhgef26 UTSW 3 62380971 missense probably damaging 1.00
R0308:Arhgef26 UTSW 3 62340399 missense probably benign 0.01
R0317:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0529:Arhgef26 UTSW 3 62339725 missense probably benign
R0825:Arhgef26 UTSW 3 62426593 missense probably damaging 0.97
R1333:Arhgef26 UTSW 3 62340323 missense probably benign 0.04
R1351:Arhgef26 UTSW 3 62380841 missense probably damaging 1.00
R1740:Arhgef26 UTSW 3 62423583 missense probably damaging 1.00
R2121:Arhgef26 UTSW 3 62340283 missense probably damaging 0.96
R2404:Arhgef26 UTSW 3 62428915 missense possibly damaging 0.90
R2437:Arhgef26 UTSW 3 62432581 missense probably damaging 0.96
R2939:Arhgef26 UTSW 3 62380910 missense possibly damaging 0.72
R3084:Arhgef26 UTSW 3 62377616 missense probably benign 0.19
R3712:Arhgef26 UTSW 3 62423629 missense probably damaging 1.00
R4005:Arhgef26 UTSW 3 62340395 missense probably benign
R4225:Arhgef26 UTSW 3 62380922 missense probably benign 0.00
R4635:Arhgef26 UTSW 3 62340440 missense probably damaging 1.00
R4961:Arhgef26 UTSW 3 62459625 missense probably damaging 1.00
R4989:Arhgef26 UTSW 3 62340385 missense possibly damaging 0.94
R5249:Arhgef26 UTSW 3 62340560 missense probably damaging 1.00
R5284:Arhgef26 UTSW 3 62419631 missense probably damaging 0.99
R5661:Arhgef26 UTSW 3 62377654 splice site probably benign
R5970:Arhgef26 UTSW 3 62340047 missense probably benign
R6022:Arhgef26 UTSW 3 62428939 missense probably damaging 1.00
R6193:Arhgef26 UTSW 3 62339792 missense possibly damaging 0.49
R6247:Arhgef26 UTSW 3 62380960 missense probably damaging 1.00
R6434:Arhgef26 UTSW 3 62428914 missense probably damaging 0.99
R6827:Arhgef26 UTSW 3 62423498 splice site probably null
R7111:Arhgef26 UTSW 3 62345268 missense possibly damaging 0.90
R7128:Arhgef26 UTSW 3 62419550 missense possibly damaging 0.94
R7360:Arhgef26 UTSW 3 62448205 missense possibly damaging 0.63
R7456:Arhgef26 UTSW 3 62340055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCGAAGTCCACTTCTAATGGCAC -3'
(R):5'- TGACCACTGCCCTTCTGTAAGACG -3'

Sequencing Primer
(F):5'- ACTTCTAATGGCACCGTGGC -3'
(R):5'- TTCTGTAAGACGTGGACCTCAAG -3'
Posted On2014-02-11