Incidental Mutation 'R1331:Trim33'
ID 156179
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Name tripartite motif-containing 33
Synonyms 8030451N04Rik, ectodermin, Ecto, Tif1g
MMRRC Submission 039396-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1331 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 103186609-103266086 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103217670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 205 (I205K)
Ref Sequence ENSEMBL: ENSMUSP00000029444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029444
AA Change: I205K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: I205K

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106860
AA Change: I205K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: I205K

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197779
Meta Mutation Damage Score 0.1780 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,773,202 (GRCm39) probably null Het
Acat1 T C 9: 53,496,183 (GRCm39) D318G probably benign Het
Ahdc1 T C 4: 132,791,002 (GRCm39) F748L probably benign Het
Alkbh8 T A 9: 3,347,916 (GRCm39) probably null Het
Arhgef26 A G 3: 62,247,449 (GRCm39) T178A probably benign Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 (GRCm39) V509A possibly damaging Het
Ccdc39 T C 3: 33,869,634 (GRCm39) E731G probably benign Het
Cenpf A G 1: 189,374,998 (GRCm39) V2931A probably damaging Het
Cobl A T 11: 12,325,853 (GRCm39) N207K probably damaging Het
Col14a1 T A 15: 55,273,584 (GRCm39) W718R unknown Het
Dnah7a A G 1: 53,507,828 (GRCm39) I3081T probably damaging Het
Dync1h1 T C 12: 110,615,698 (GRCm39) V2977A probably damaging Het
Ephb4 A G 5: 137,364,796 (GRCm39) probably benign Het
Eri3 T C 4: 117,422,104 (GRCm39) probably benign Het
Fbxo24 A G 5: 137,617,891 (GRCm39) V291A probably damaging Het
Glra1 A C 11: 55,405,896 (GRCm39) S282A probably benign Het
Gm7589 C A 9: 59,053,325 (GRCm39) noncoding transcript Het
H6pd T C 4: 150,066,872 (GRCm39) N505D probably benign Het
Hdlbp T A 1: 93,348,853 (GRCm39) N566Y probably damaging Het
Hsp90aa1 C A 12: 110,659,254 (GRCm39) K514N probably damaging Het
Impdh1 A T 6: 29,206,477 (GRCm39) V120D probably damaging Het
Katnip A G 7: 125,465,627 (GRCm39) T1360A probably benign Het
Loxhd1 C T 18: 77,490,632 (GRCm39) P1411S possibly damaging Het
Lpl A G 8: 69,349,281 (GRCm39) E269G probably damaging Het
Map1a G T 2: 121,136,701 (GRCm39) E2268* probably null Het
Mark1 T C 1: 184,660,245 (GRCm39) E137G probably damaging Het
Mki67 A T 7: 135,300,005 (GRCm39) S1676R possibly damaging Het
Mogat2 T C 7: 98,872,722 (GRCm39) Y154C possibly damaging Het
Myo18a C G 11: 77,732,405 (GRCm39) I859M probably benign Het
Myo7a A G 7: 97,756,215 (GRCm39) V39A probably benign Het
Nedd4 T A 9: 72,584,668 (GRCm39) I123N probably damaging Het
Obscn A G 11: 58,977,754 (GRCm39) V1966A probably benign Het
Or7g33 T C 9: 19,448,842 (GRCm39) N128S probably benign Het
Orc3 T G 4: 34,599,748 (GRCm39) N77T probably benign Het
Penk A G 4: 4,134,287 (GRCm39) M120T probably benign Het
Phf7 G A 14: 30,962,362 (GRCm39) Q148* probably null Het
Pkhd1l1 G A 15: 44,368,943 (GRCm39) V863I probably damaging Het
Pkhd1l1 C T 15: 44,452,993 (GRCm39) R3973C probably damaging Het
Polq C T 16: 36,862,109 (GRCm39) T264M probably damaging Het
Ptprb A T 10: 116,203,437 (GRCm39) T2070S probably damaging Het
Ralgapb T C 2: 158,272,453 (GRCm39) F169S probably damaging Het
Rapgef5 G T 12: 117,685,084 (GRCm39) A278S probably benign Het
Ripor2 G T 13: 24,861,824 (GRCm39) E203* probably null Het
Setx T C 2: 29,069,698 (GRCm39) L2501P probably benign Het
Sh3bgrl2 C T 9: 83,459,684 (GRCm39) probably benign Het
Slc35b1 T A 11: 95,276,689 (GRCm39) V56D probably damaging Het
Slc45a4 C T 15: 73,458,596 (GRCm39) D326N probably benign Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stat4 T A 1: 52,053,086 (GRCm39) V89D probably benign Het
Tek T A 4: 94,627,943 (GRCm39) probably benign Het
Tert T A 13: 73,796,473 (GRCm39) F1068Y probably damaging Het
Vmn1r212 A T 13: 23,067,562 (GRCm39) I257K probably benign Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103,237,498 (GRCm39) missense probably benign 0.44
IGL00981:Trim33 APN 3 103,259,311 (GRCm39) splice site probably benign
IGL01010:Trim33 APN 3 103,254,031 (GRCm39) nonsense probably null
IGL01025:Trim33 APN 3 103,261,234 (GRCm39) utr 3 prime probably benign
IGL01082:Trim33 APN 3 103,234,175 (GRCm39) missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103,254,086 (GRCm39) critical splice donor site probably null
IGL02291:Trim33 APN 3 103,234,181 (GRCm39) missense probably damaging 1.00
IGL03248:Trim33 APN 3 103,218,289 (GRCm39) unclassified probably benign
IGL03400:Trim33 APN 3 103,236,459 (GRCm39) missense probably damaging 0.99
abilene UTSW 3 103,228,875 (GRCm39) missense probably damaging 0.99
Bemoaned UTSW 3 103,234,109 (GRCm39) missense possibly damaging 0.92
Excision UTSW 3 103,251,892 (GRCm39) missense probably damaging 1.00
Peaked UTSW 3 103,244,848 (GRCm39) critical splice donor site probably null
Pike UTSW 3 103,218,201 (GRCm39) missense probably damaging 0.98
westworld UTSW 3 103,234,217 (GRCm39) missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103,259,417 (GRCm39) missense probably benign 0.00
R0471:Trim33 UTSW 3 103,234,217 (GRCm39) missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103,217,700 (GRCm39) missense probably damaging 1.00
R0573:Trim33 UTSW 3 103,259,306 (GRCm39) splice site probably benign
R0586:Trim33 UTSW 3 103,217,660 (GRCm39) missense probably damaging 0.99
R1103:Trim33 UTSW 3 103,218,201 (GRCm39) missense probably damaging 0.98
R1157:Trim33 UTSW 3 103,261,146 (GRCm39) missense probably damaging 1.00
R1328:Trim33 UTSW 3 103,260,913 (GRCm39) missense possibly damaging 0.86
R1385:Trim33 UTSW 3 103,218,266 (GRCm39) missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103,217,750 (GRCm39) unclassified probably benign
R1785:Trim33 UTSW 3 103,236,536 (GRCm39) frame shift probably null
R1848:Trim33 UTSW 3 103,231,956 (GRCm39) unclassified probably benign
R1903:Trim33 UTSW 3 103,244,760 (GRCm39) missense probably damaging 1.00
R3404:Trim33 UTSW 3 103,228,875 (GRCm39) missense probably damaging 0.99
R3878:Trim33 UTSW 3 103,259,321 (GRCm39) missense probably damaging 1.00
R4156:Trim33 UTSW 3 103,217,630 (GRCm39) missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103,236,402 (GRCm39) missense probably damaging 0.99
R4570:Trim33 UTSW 3 103,237,481 (GRCm39) missense probably damaging 0.96
R4809:Trim33 UTSW 3 103,236,572 (GRCm39) missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103,238,963 (GRCm39) missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103,248,997 (GRCm39) nonsense probably null
R5458:Trim33 UTSW 3 103,237,496 (GRCm39) missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103,251,892 (GRCm39) missense probably damaging 1.00
R6195:Trim33 UTSW 3 103,244,848 (GRCm39) critical splice donor site probably null
R6331:Trim33 UTSW 3 103,248,925 (GRCm39) missense probably benign 0.00
R6636:Trim33 UTSW 3 103,261,035 (GRCm39) missense probably damaging 1.00
R6642:Trim33 UTSW 3 103,244,830 (GRCm39) missense probably damaging 0.99
R6783:Trim33 UTSW 3 103,259,403 (GRCm39) missense probably damaging 1.00
R6856:Trim33 UTSW 3 103,259,365 (GRCm39) missense probably damaging 0.97
R7220:Trim33 UTSW 3 103,234,109 (GRCm39) missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103,228,952 (GRCm39) missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103,217,639 (GRCm39) missense probably damaging 0.98
R7430:Trim33 UTSW 3 103,218,219 (GRCm39) missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103,253,956 (GRCm39) splice site probably benign
R7491:Trim33 UTSW 3 103,233,464 (GRCm39) missense probably benign 0.28
R8001:Trim33 UTSW 3 103,218,831 (GRCm39) critical splice donor site probably null
R8127:Trim33 UTSW 3 103,239,043 (GRCm39) missense possibly damaging 0.66
R8326:Trim33 UTSW 3 103,218,770 (GRCm39) nonsense probably null
R8334:Trim33 UTSW 3 103,261,145 (GRCm39) missense probably benign 0.06
R8813:Trim33 UTSW 3 103,254,052 (GRCm39) missense probably benign 0.01
R8828:Trim33 UTSW 3 103,236,392 (GRCm39) missense probably damaging 0.97
R8894:Trim33 UTSW 3 103,218,807 (GRCm39) missense probably damaging 1.00
R9239:Trim33 UTSW 3 103,237,453 (GRCm39) missense probably benign 0.08
R9433:Trim33 UTSW 3 103,228,979 (GRCm39) critical splice donor site probably null
R9495:Trim33 UTSW 3 103,239,074 (GRCm39) missense probably benign 0.17
R9514:Trim33 UTSW 3 103,239,074 (GRCm39) missense probably benign 0.17
R9564:Trim33 UTSW 3 103,238,965 (GRCm39) missense probably benign 0.28
R9595:Trim33 UTSW 3 103,259,350 (GRCm39) missense probably damaging 1.00
R9722:Trim33 UTSW 3 103,261,146 (GRCm39) missense possibly damaging 0.55
R9784:Trim33 UTSW 3 103,244,823 (GRCm39) missense possibly damaging 0.66
RF005:Trim33 UTSW 3 103,187,528 (GRCm39) frame shift probably null
RF007:Trim33 UTSW 3 103,187,533 (GRCm39) small deletion probably benign
RF014:Trim33 UTSW 3 103,236,408 (GRCm39) missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103,187,533 (GRCm39) small deletion probably benign
RF064:Trim33 UTSW 3 103,187,511 (GRCm39) frame shift probably null
Z1176:Trim33 UTSW 3 103,261,043 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGGAAATAACTCAAACTGCTTTGT -3'
(R):5'- AAACCAACTGCACTTGCATTATCTTCAC -3'

Sequencing Primer
(F):5'- AACTCAAACTGCTTTGTTCATGTC -3'
(R):5'- TCTTAGGGTGTGGAAGAGTAATC -3'
Posted On 2014-02-11