Mutagenetix > Incidental Mutations

Incidental Mutation 'R1331:Mki67'

156193

Institutional Source

Beutler Lab

Gene Symbol

Mki67

Ensembl Gene

ENSMUSG00000031004

Gene Name

antigen identified by monoclonal antibody Ki 67

Synonyms

D630048A14Rik, Ki-67, Ki67

MMRRC Submission

039396-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.823) question?

Stock #

R1331 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135689784-135716361 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135698276 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1676 (S1676R)

Ref Sequence

ENSEMBL: ENSMUSP00000033310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033310]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033310
AA Change: S1676R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: S1676R

Domain	Start	End	E-Value	Type
FHA	26	76	1.03e-11	SMART
Pfam:PP1_bind	462	519	2.8e-20	PFAM
low complexity region	535	545	N/A	INTRINSIC
low complexity region	869	882	N/A	INTRINSIC
Pfam:K167R	889	982	1.5e-9	PFAM
K167R	993	1102	2.01e-39	SMART
K167R	1107	1217	1.87e-57	SMART
K167R	1228	1337	1.33e-53	SMART
K167R	1348	1451	6.57e-44	SMART
K167R	1462	1570	9.09e-38	SMART
K167R	1580	1686	5.02e-40	SMART
K167R	1697	1807	9.6e-37	SMART
K167R	1818	1926	5.94e-51	SMART
K167R	1937	2047	1.6e-56	SMART
K167R	2058	2164	4.04e-53	SMART
K167R	2175	2285	1.52e-57	SMART
K167R	2296	2407	1.78e-40	SMART
K167R	2418	2527	1.71e-42	SMART
K167R	2538	2640	7.41e-20	SMART
K167R	2642	2750	1.06e-38	SMART
K167R	2761	2872	2.1e-42	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.2%
20x: 93.0%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap1	A	T	11: 69,882,376		probably null	Het
Acat1	T	C	9: 53,584,883	D318G	probably benign	Het
Ahdc1	T	C	4: 133,063,691	F748L	probably benign	Het
Alkbh8	T	A	9: 3,347,916		probably null	Het
Arhgef26	A	G	3: 62,340,028	T178A	probably benign	Het
Bid	C	T	6: 120,897,255	A110T	possibly damaging	Het
Ccdc180	T	C	4: 45,909,359	V509A	possibly damaging	Het
Ccdc39	T	C	3: 33,815,485	E731G	probably benign	Het
Cenpf	A	G	1: 189,642,801	V2931A	probably damaging	Het
Cobl	A	T	11: 12,375,853	N207K	probably damaging	Het
Col14a1	T	A	15: 55,410,188	W718R	unknown	Het
D430042O09Rik	A	G	7: 125,866,455	T1360A	probably benign	Het
Dnah7a	A	G	1: 53,468,669	I3081T	probably damaging	Het
Dync1h1	T	C	12: 110,649,264	V2977A	probably damaging	Het
Ephb4	A	G	5: 137,366,534		probably benign	Het
Eri3	T	C	4: 117,564,907		probably benign	Het
Fbxo24	A	G	5: 137,619,629	V291A	probably damaging	Het
Glra1	A	C	11: 55,515,070	S282A	probably benign	Het
Gm7589	C	A	9: 59,146,042		noncoding transcript	Het
H6pd	T	C	4: 149,982,415	N505D	probably benign	Het
Hdlbp	T	A	1: 93,421,131	N566Y	probably damaging	Het
Hsp90aa1	C	A	12: 110,692,820	K514N	probably damaging	Het
Impdh1	A	T	6: 29,206,478	V120D	probably damaging	Het
Loxhd1	C	T	18: 77,402,936	P1411S	possibly damaging	Het
Lpl	A	G	8: 68,896,629	E269G	probably damaging	Het
Map1a	G	T	2: 121,306,220	E2268*	probably null	Het
Mark1	T	C	1: 184,928,048	E137G	probably damaging	Het
Mogat2	T	C	7: 99,223,515	Y154C	possibly damaging	Het
Myo18a	C	G	11: 77,841,579	I859M	probably benign	Het
Myo7a	A	G	7: 98,107,008	V39A	probably benign	Het
Nedd4	T	A	9: 72,677,386	I123N	probably damaging	Het
Obscn	A	G	11: 59,086,928	V1966A	probably benign	Het
Olfr853	T	C	9: 19,537,546	N128S	probably benign	Het
Orc3	T	G	4: 34,599,748	N77T	probably benign	Het
Penk	A	G	4: 4,134,287	M120T	probably benign	Het
Phf7	G	A	14: 31,240,405	Q148*	probably null	Het
Pkhd1l1	G	A	15: 44,505,547	V863I	probably damaging	Het
Pkhd1l1	C	T	15: 44,589,597	R3973C	probably damaging	Het
Polq	C	T	16: 37,041,747	T264M	probably damaging	Het
Ptprb	A	T	10: 116,367,532	T2070S	probably damaging	Het
Ralgapb	T	C	2: 158,430,533	F169S	probably damaging	Het
Rapgef5	G	T	12: 117,721,349	A278S	probably benign	Het
Ripor2	G	T	13: 24,677,841	E203*	probably null	Het
Setx	T	C	2: 29,179,686	L2501P	probably benign	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Slc35b1	T	A	11: 95,385,863	V56D	probably damaging	Het
Slc45a4	C	T	15: 73,586,747	D326N	probably benign	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stat4	T	A	1: 52,013,927	V89D	probably benign	Het
Tek	T	A	4: 94,739,706		probably benign	Het
Tert	T	A	13: 73,648,354	F1068Y	probably damaging	Het
Trim33	T	A	3: 103,310,354	I205K	probably damaging	Het
Vmn1r212	A	T	13: 22,883,392	I257K	probably benign	Het

Other mutations in Mki67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Mki67	APN	7	135690120	missense	probably benign	0.32
IGL00264:Mki67	APN	7	135707820	nonsense	probably null
IGL00328:Mki67	APN	7	135696695	missense	probably benign	0.03
IGL00570:Mki67	APN	7	135708101	missense	possibly damaging	0.88
IGL00584:Mki67	APN	7	135695695	missense	probably damaging	1.00
IGL00756:Mki67	APN	7	135698731	missense	possibly damaging	0.76
IGL01063:Mki67	APN	7	135694922	missense	possibly damaging	0.93
IGL01112:Mki67	APN	7	135714016	missense	probably damaging	1.00
IGL01360:Mki67	APN	7	135705776	missense	probably damaging	1.00
IGL01457:Mki67	APN	7	135699546	missense	probably benign	0.00
IGL01686:Mki67	APN	7	135707813	missense	probably benign	0.00
IGL01731:Mki67	APN	7	135696549	missense	probably benign	0.03
IGL01775:Mki67	APN	7	135698276	missense	possibly damaging	0.71
IGL01806:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01860:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01938:Mki67	APN	7	135694330	missense	probably benign	0.04
IGL02249:Mki67	APN	7	135700522	missense	possibly damaging	0.47
IGL02260:Mki67	APN	7	135701968	missense	probably benign	0.00
IGL02270:Mki67	APN	7	135698632	missense	probably damaging	1.00
IGL02406:Mki67	APN	7	135698793	missense	probably benign	0.00
IGL02499:Mki67	APN	7	135694327	missense	possibly damaging	0.94
IGL02655:Mki67	APN	7	135714019	missense	probably damaging	0.98
IGL02700:Mki67	APN	7	135708202	missense	probably benign	0.02
IGL03370:Mki67	APN	7	135695490	missense	probably benign	0.00
BB003:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
BB013:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
PIT4468001:Mki67	UTSW	7	135699147	missense	probably benign	0.00
R0001:Mki67	UTSW	7	135699172	missense	probably damaging	1.00
R0001:Mki67	UTSW	7	135701019	missense	probably damaging	0.99
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0102:Mki67	UTSW	7	135713803	missense	probably benign	0.16
R0130:Mki67	UTSW	7	135696459	missense	probably damaging	1.00
R0149:Mki67	UTSW	7	135698424	missense	probably benign	0.00
R0356:Mki67	UTSW	7	135704406	missense	probably benign	0.34
R0482:Mki67	UTSW	7	135699429	missense	possibly damaging	0.60
R0508:Mki67	UTSW	7	135700346	missense	probably benign
R0532:Mki67	UTSW	7	135698164	nonsense	probably null
R0548:Mki67	UTSW	7	135695256	missense	probably damaging	1.00
R0548:Mki67	UTSW	7	135696908	missense	possibly damaging	0.82
R0557:Mki67	UTSW	7	135699261	missense	possibly damaging	0.48
R0627:Mki67	UTSW	7	135708258	missense	probably benign	0.31
R0631:Mki67	UTSW	7	135704388	missense	probably damaging	0.98
R0848:Mki67	UTSW	7	135701043	missense	probably benign	0.21
R1075:Mki67	UTSW	7	135697311	missense	probably benign	0.03
R1105:Mki67	UTSW	7	135701050	missense	probably benign	0.09
R1272:Mki67	UTSW	7	135700414	nonsense	probably null
R1486:Mki67	UTSW	7	135699720	missense	probably benign	0.00
R1510:Mki67	UTSW	7	135696171	missense	probably benign	0.26
R1573:Mki67	UTSW	7	135695116	missense	possibly damaging	0.93
R1586:Mki67	UTSW	7	135713972	nonsense	probably null
R1599:Mki67	UTSW	7	135699934	missense	probably benign	0.34
R1623:Mki67	UTSW	7	135708818	splice site	probably null
R1706:Mki67	UTSW	7	135700566	missense	probably benign	0.37
R1718:Mki67	UTSW	7	135695494	missense	probably damaging	1.00
R1785:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R1816:Mki67	UTSW	7	135707387	missense	possibly damaging	0.68
R1862:Mki67	UTSW	7	135699361	missense	probably benign	0.09
R1929:Mki67	UTSW	7	135698065	missense	possibly damaging	0.46
R1957:Mki67	UTSW	7	135698399	missense	probably benign	0.01
R1971:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R1998:Mki67	UTSW	7	135705770	missense	probably benign	0.00
R2004:Mki67	UTSW	7	135698509	nonsense	probably null
R2005:Mki67	UTSW	7	135698509	nonsense	probably null
R2006:Mki67	UTSW	7	135698509	nonsense	probably null
R2109:Mki67	UTSW	7	135697863	missense	probably damaging	1.00
R2130:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2131:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2133:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2140:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2141:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2142:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2284:Mki67	UTSW	7	135699945	missense	probably damaging	0.99
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2913:Mki67	UTSW	7	135700686	missense	possibly damaging	0.71
R3404:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3405:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3406:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3777:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3778:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3787:Mki67	UTSW	7	135700283	missense	possibly damaging	0.93
R3847:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3848:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3853:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3971:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3972:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R4258:Mki67	UTSW	7	135695288	missense	possibly damaging	0.86
R4343:Mki67	UTSW	7	135695118	missense	probably benign	0.10
R4488:Mki67	UTSW	7	135697671	missense	probably benign	0.01
R4528:Mki67	UTSW	7	135695359	missense	probably damaging	1.00
R4713:Mki67	UTSW	7	135695469	missense	probably benign	0.35
R4867:Mki67	UTSW	7	135699856	missense	probably damaging	0.97
R4874:Mki67	UTSW	7	135708771	missense	probably damaging	0.97
R4897:Mki67	UTSW	7	135696745	missense	probably damaging	1.00
R5045:Mki67	UTSW	7	135707904	missense	possibly damaging	0.84
R5306:Mki67	UTSW	7	135714001	missense	probably damaging	1.00
R5309:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5312:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5379:Mki67	UTSW	7	135697461	missense	possibly damaging	0.95
R5506:Mki67	UTSW	7	135699981	missense	possibly damaging	0.60
R5513:Mki67	UTSW	7	135707750	missense	probably damaging	0.98
R5742:Mki67	UTSW	7	135704373	missense	probably benign	0.20
R5806:Mki67	UTSW	7	135704605	missense	probably damaging	1.00
R6008:Mki67	UTSW	7	135697429	missense	probably damaging	1.00
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6221:Mki67	UTSW	7	135697914	missense	probably benign	0.18
R6294:Mki67	UTSW	7	135704590	missense	probably benign	0.09
R6377:Mki67	UTSW	7	135696321	missense	possibly damaging	0.67
R6456:Mki67	UTSW	7	135699475	missense	possibly damaging	0.59
R6608:Mki67	UTSW	7	135698361	missense	probably benign	0.01
R6609:Mki67	UTSW	7	135699829	missense	possibly damaging	0.94
R6648:Mki67	UTSW	7	135697440	missense	probably damaging	1.00
R6901:Mki67	UTSW	7	135708760	splice site	probably null
R6978:Mki67	UTSW	7	135701962	missense	probably benign	0.10
R6985:Mki67	UTSW	7	135713865	missense	probably damaging	1.00
R7076:Mki67	UTSW	7	135705629	missense	probably damaging	0.98
R7217:Mki67	UTSW	7	135704182	missense	probably damaging	1.00
R7239:Mki67	UTSW	7	135700176	missense	possibly damaging	0.91
R7250:Mki67	UTSW	7	135699324	missense	possibly damaging	0.90
R7313:Mki67	UTSW	7	135694671	missense	probably benign	0.29
R7336:Mki67	UTSW	7	135713839	missense	probably benign	0.03
R7422:Mki67	UTSW	7	135698370	missense	probably damaging	1.00
R7451:Mki67	UTSW	7	135699351	missense	probably benign	0.01
R7502:Mki67	UTSW	7	135700783	missense	possibly damaging	0.53
R7513:Mki67	UTSW	7	135693223	missense	probably benign
R7578:Mki67	UTSW	7	135700915	missense	possibly damaging	0.68
R7619:Mki67	UTSW	7	135699377	missense	probably benign	0.01
R7646:Mki67	UTSW	7	135696769	missense	possibly damaging	0.63
R7659:Mki67	UTSW	7	135697426	missense	probably damaging	1.00
R7691:Mki67	UTSW	7	135701992	missense	not run
R7780:Mki67	UTSW	7	135713968	missense	probably benign	0.02
R7796:Mki67	UTSW	7	135698194	missense	probably damaging	1.00
R7904:Mki67	UTSW	7	135693087	missense	possibly damaging	0.90
R7911:Mki67	UTSW	7	135704604	missense	probably damaging	1.00
R7921:Mki67	UTSW	7	135695204	missense	probably benign	0.01
R7926:Mki67	UTSW	7	135697140	missense	possibly damaging	0.91
R7950:Mki67	UTSW	7	135699724	nonsense	probably null
R8130:Mki67	UTSW	7	135697564	missense	probably damaging	1.00
R8145:Mki67	UTSW	7	135694336	missense	probably benign	0.07
R8196:Mki67	UTSW	7	135695508	missense	probably damaging	1.00
R8220:Mki67	UTSW	7	135698121	missense	probably benign	0.03
R8299:Mki67	UTSW	7	135704620	missense	probably damaging	1.00
R8334:Mki67	UTSW	7	135696516	missense	probably damaging	0.98
R8350:Mki67	UTSW	7	135698471	missense	possibly damaging	0.82
R8358:Mki67	UTSW	7	135700126	missense	possibly damaging	0.46
R8529:Mki67	UTSW	7	135713959	critical splice donor site	probably null
X0020:Mki67	UTSW	7	135714001	missense	probably damaging	0.96
X0065:Mki67	UTSW	7	135713844	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGCTGACAGTTCGACTTGCTGATG -3'
(R):5'- CCACTGGAATCTCAACAATGCTTGC -3'

Sequencing Primer
(F):5'- TGTAGCACACTGTGGCAGAC -3'
(R):5'- GCTTGCTAGATCACCACAATTAGG -3'

Posted On

2014-02-11