Incidental Mutation 'R1331:Acat1'
ID156197
Institutional Source Beutler Lab
Gene Symbol Acat1
Ensembl Gene ENSMUSG00000032047
Gene Nameacetyl-Coenzyme A acetyltransferase 1
Synonyms6330585C21Rik, Acat
MMRRC Submission 039396-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R1331 (G1)
Quality Score144
Status Validated
Chromosome9
Chromosomal Location53580522-53610382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53584883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 318 (D318G)
Ref Sequence ENSEMBL: ENSMUSP00000034547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034547]
Predicted Effect probably benign
Transcript: ENSMUST00000034547
AA Change: D318G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034547
Gene: ENSMUSG00000032047
AA Change: D318G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:Thiolase_N 39 296 3.7e-98 PFAM
Pfam:ketoacyl-synt 104 166 1.1e-8 PFAM
Pfam:Thiolase_C 303 423 1.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169317
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,882,376 probably null Het
Ahdc1 T C 4: 133,063,691 F748L probably benign Het
Alkbh8 T A 9: 3,347,916 probably null Het
Arhgef26 A G 3: 62,340,028 T178A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 V509A possibly damaging Het
Ccdc39 T C 3: 33,815,485 E731G probably benign Het
Cenpf A G 1: 189,642,801 V2931A probably damaging Het
Cobl A T 11: 12,375,853 N207K probably damaging Het
Col14a1 T A 15: 55,410,188 W718R unknown Het
D430042O09Rik A G 7: 125,866,455 T1360A probably benign Het
Dnah7a A G 1: 53,468,669 I3081T probably damaging Het
Dync1h1 T C 12: 110,649,264 V2977A probably damaging Het
Ephb4 A G 5: 137,366,534 probably benign Het
Eri3 T C 4: 117,564,907 probably benign Het
Fbxo24 A G 5: 137,619,629 V291A probably damaging Het
Glra1 A C 11: 55,515,070 S282A probably benign Het
Gm7589 C A 9: 59,146,042 noncoding transcript Het
H6pd T C 4: 149,982,415 N505D probably benign Het
Hdlbp T A 1: 93,421,131 N566Y probably damaging Het
Hsp90aa1 C A 12: 110,692,820 K514N probably damaging Het
Impdh1 A T 6: 29,206,478 V120D probably damaging Het
Loxhd1 C T 18: 77,402,936 P1411S possibly damaging Het
Lpl A G 8: 68,896,629 E269G probably damaging Het
Map1a G T 2: 121,306,220 E2268* probably null Het
Mark1 T C 1: 184,928,048 E137G probably damaging Het
Mki67 A T 7: 135,698,276 S1676R possibly damaging Het
Mogat2 T C 7: 99,223,515 Y154C possibly damaging Het
Myo18a C G 11: 77,841,579 I859M probably benign Het
Myo7a A G 7: 98,107,008 V39A probably benign Het
Nedd4 T A 9: 72,677,386 I123N probably damaging Het
Obscn A G 11: 59,086,928 V1966A probably benign Het
Olfr853 T C 9: 19,537,546 N128S probably benign Het
Orc3 T G 4: 34,599,748 N77T probably benign Het
Penk A G 4: 4,134,287 M120T probably benign Het
Phf7 G A 14: 31,240,405 Q148* probably null Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pkhd1l1 C T 15: 44,589,597 R3973C probably damaging Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Ptprb A T 10: 116,367,532 T2070S probably damaging Het
Ralgapb T C 2: 158,430,533 F169S probably damaging Het
Rapgef5 G T 12: 117,721,349 A278S probably benign Het
Ripor2 G T 13: 24,677,841 E203* probably null Het
Setx T C 2: 29,179,686 L2501P probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc35b1 T A 11: 95,385,863 V56D probably damaging Het
Slc45a4 C T 15: 73,586,747 D326N probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat4 T A 1: 52,013,927 V89D probably benign Het
Tek T A 4: 94,739,706 probably benign Het
Tert T A 13: 73,648,354 F1068Y probably damaging Het
Trim33 T A 3: 103,310,354 I205K probably damaging Het
Vmn1r212 A T 13: 22,883,392 I257K probably benign Het
Other mutations in Acat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Acat1 APN 9 53582595 missense probably damaging 0.98
IGL02160:Acat1 APN 9 53591987 missense probably benign 0.00
IGL02246:Acat1 APN 9 53584866 missense probably benign 0.06
IGL02582:Acat1 APN 9 53594745 missense probably benign 0.37
IGL03028:Acat1 APN 9 53594762 missense probably benign 0.14
R0637:Acat1 UTSW 9 53587531 missense probably damaging 1.00
R1200:Acat1 UTSW 9 53583510 missense possibly damaging 0.90
R1302:Acat1 UTSW 9 53589225 missense possibly damaging 0.70
R3683:Acat1 UTSW 9 53587465 missense probably damaging 1.00
R4829:Acat1 UTSW 9 53591456 missense probably damaging 1.00
R5035:Acat1 UTSW 9 53583510 missense probably benign 0.00
R5354:Acat1 UTSW 9 53589183 missense possibly damaging 0.91
R5411:Acat1 UTSW 9 53582646 missense probably damaging 1.00
R5521:Acat1 UTSW 9 53583507 nonsense probably null
R5634:Acat1 UTSW 9 53583621 intron probably benign
R5905:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6028:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6925:Acat1 UTSW 9 53592029 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTTTACCACTCCAGGGGTAAGCA -3'
(R):5'- ACCTCTCTCCAGGCAAATCAGTGT -3'

Sequencing Primer
(F):5'- TACAAGTGATTCAGCTATCCGC -3'
(R):5'- ttagaaggaaggggcagtaaag -3'
Posted On2014-02-11