Incidental Mutation 'R1331:Slc45a4'
ID156218
Institutional Source Beutler Lab
Gene Symbol Slc45a4
Ensembl Gene ENSMUSG00000079020
Gene Namesolute carrier family 45, member 4
Synonyms9330175B01Rik
MMRRC Submission 039396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1331 (G1)
Quality Score212
Status Validated
Chromosome15
Chromosomal Location73577424-73645762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73586747 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 326 (D326N)
Ref Sequence ENSEMBL: ENSMUSP00000054651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054266] [ENSMUST00000076224] [ENSMUST00000132607] [ENSMUST00000151288]
Predicted Effect probably benign
Transcript: ENSMUST00000054266
AA Change: D326N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054651
Gene: ENSMUSG00000079020
AA Change: D326N

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 501 518 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
transmembrane domain 585 604 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 685 707 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
low complexity region 754 770 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076224
AA Change: D318N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075577
Gene: ENSMUSG00000079020
AA Change: D318N

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132607
AA Change: D124N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115827
Gene: ENSMUSG00000079020
AA Change: D124N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
low complexity region 286 297 N/A INTRINSIC
low complexity region 299 316 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
transmembrane domain 383 402 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144936
AA Change: D253N
SMART Domains Protein: ENSMUSP00000122825
Gene: ENSMUSG00000079020
AA Change: D253N

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
transmembrane domain 461 483 N/A INTRINSIC
transmembrane domain 513 532 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
transmembrane domain 571 593 N/A INTRINSIC
transmembrane domain 613 635 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 682 698 N/A INTRINSIC
low complexity region 703 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151288
AA Change: D318N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121775
Gene: ENSMUSG00000079020
AA Change: D318N

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152558
SMART Domains Protein: ENSMUSP00000114790
Gene: ENSMUSG00000079020

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 112 131 N/A INTRINSIC
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 93.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A T 11: 69,882,376 probably null Het
Acat1 T C 9: 53,584,883 D318G probably benign Het
Ahdc1 T C 4: 133,063,691 F748L probably benign Het
Alkbh8 T A 9: 3,347,916 probably null Het
Arhgef26 A G 3: 62,340,028 T178A probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Ccdc180 T C 4: 45,909,359 V509A possibly damaging Het
Ccdc39 T C 3: 33,815,485 E731G probably benign Het
Cenpf A G 1: 189,642,801 V2931A probably damaging Het
Cobl A T 11: 12,375,853 N207K probably damaging Het
Col14a1 T A 15: 55,410,188 W718R unknown Het
D430042O09Rik A G 7: 125,866,455 T1360A probably benign Het
Dnah7a A G 1: 53,468,669 I3081T probably damaging Het
Dync1h1 T C 12: 110,649,264 V2977A probably damaging Het
Ephb4 A G 5: 137,366,534 probably benign Het
Eri3 T C 4: 117,564,907 probably benign Het
Fbxo24 A G 5: 137,619,629 V291A probably damaging Het
Glra1 A C 11: 55,515,070 S282A probably benign Het
Gm7589 C A 9: 59,146,042 noncoding transcript Het
H6pd T C 4: 149,982,415 N505D probably benign Het
Hdlbp T A 1: 93,421,131 N566Y probably damaging Het
Hsp90aa1 C A 12: 110,692,820 K514N probably damaging Het
Impdh1 A T 6: 29,206,478 V120D probably damaging Het
Loxhd1 C T 18: 77,402,936 P1411S possibly damaging Het
Lpl A G 8: 68,896,629 E269G probably damaging Het
Map1a G T 2: 121,306,220 E2268* probably null Het
Mark1 T C 1: 184,928,048 E137G probably damaging Het
Mki67 A T 7: 135,698,276 S1676R possibly damaging Het
Mogat2 T C 7: 99,223,515 Y154C possibly damaging Het
Myo18a C G 11: 77,841,579 I859M probably benign Het
Myo7a A G 7: 98,107,008 V39A probably benign Het
Nedd4 T A 9: 72,677,386 I123N probably damaging Het
Obscn A G 11: 59,086,928 V1966A probably benign Het
Olfr853 T C 9: 19,537,546 N128S probably benign Het
Orc3 T G 4: 34,599,748 N77T probably benign Het
Penk A G 4: 4,134,287 M120T probably benign Het
Phf7 G A 14: 31,240,405 Q148* probably null Het
Pkhd1l1 G A 15: 44,505,547 V863I probably damaging Het
Pkhd1l1 C T 15: 44,589,597 R3973C probably damaging Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Ptprb A T 10: 116,367,532 T2070S probably damaging Het
Ralgapb T C 2: 158,430,533 F169S probably damaging Het
Rapgef5 G T 12: 117,721,349 A278S probably benign Het
Ripor2 G T 13: 24,677,841 E203* probably null Het
Setx T C 2: 29,179,686 L2501P probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slc35b1 T A 11: 95,385,863 V56D probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stat4 T A 1: 52,013,927 V89D probably benign Het
Tek T A 4: 94,739,706 probably benign Het
Tert T A 13: 73,648,354 F1068Y probably damaging Het
Trim33 T A 3: 103,310,354 I205K probably damaging Het
Vmn1r212 A T 13: 22,883,392 I257K probably benign Het
Other mutations in Slc45a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Slc45a4 APN 15 73587655 missense probably damaging 1.00
IGL02506:Slc45a4 APN 15 73581838 missense probably benign 0.00
IGL02642:Slc45a4 APN 15 73586815 missense probably benign
IGL03195:Slc45a4 APN 15 73584423 missense possibly damaging 0.89
Undefined UTSW 15 73584450 missense probably damaging 1.00
R0048:Slc45a4 UTSW 15 73605436 splice site probably benign
R0189:Slc45a4 UTSW 15 73581914 missense probably benign 0.00
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0828:Slc45a4 UTSW 15 73586816 missense probably benign 0.01
R1172:Slc45a4 UTSW 15 73605429 splice site probably benign
R1739:Slc45a4 UTSW 15 73586038 missense probably damaging 1.00
R2310:Slc45a4 UTSW 15 73589560 missense probably damaging 1.00
R4695:Slc45a4 UTSW 15 73582075 missense possibly damaging 0.94
R4904:Slc45a4 UTSW 15 73586842 missense probably benign 0.18
R4974:Slc45a4 UTSW 15 73584450 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6114:Slc45a4 UTSW 15 73605604 missense probably damaging 0.96
R7057:Slc45a4 UTSW 15 73587638 missense probably damaging 1.00
R7221:Slc45a4 UTSW 15 73586410 missense probably benign 0.06
R7288:Slc45a4 UTSW 15 73586936 nonsense probably null
R7331:Slc45a4 UTSW 15 73605640 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTAGAAGCCTGCCTGTGAAAC -3'
(R):5'- GCTCTGCATCTCTTCAGCATCGAG -3'

Sequencing Primer
(F):5'- TATCAAGCAAGGTGTCGTCC -3'
(R):5'- CTTCAGCATCGAGGAGGAGC -3'
Posted On2014-02-11