Incidental Mutation 'R1358:Rnase2b'
ID156231
Institutional Source Beutler Lab
Gene Symbol Rnase2b
Ensembl Gene ENSMUSG00000059606
Gene Nameribonuclease, RNase A family, 2B (liver, eosinophil-derived neurotoxin)
SynonymsEar5, murine ribonuclease 5, mR5
MMRRC Submission 039423-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1358 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51162260-51163018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51162689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 76 (V76I)
Ref Sequence ENSEMBL: ENSMUSP00000075074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075648]
Predicted Effect probably damaging
Transcript: ENSMUST00000075648
AA Change: V76I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075074
Gene: ENSMUSG00000059606
AA Change: V76I

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
RNAse_Pc 27 155 1.26e-48 SMART
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.2%
  • 20x: 80.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Helz2 G A 2: 181,232,981 R1907C probably damaging Het
Kcnj12 C A 11: 61,069,887 P235H probably benign Het
Slc52a2 G A 15: 76,540,069 R169H probably benign Het
Sptb CTT CTTT 12: 76,621,321 probably null Het
Sptb C T 12: 76,621,326 G666S probably damaging Het
Vmn2r39 A T 7: 9,023,688 F438Y possibly damaging Het
Other mutations in Rnase2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02089:Rnase2b APN 14 51162783 missense probably benign 0.04
IGL02947:Rnase2b APN 14 51162807 missense probably damaging 1.00
R1359:Rnase2b UTSW 14 51162689 missense probably damaging 1.00
R1361:Rnase2b UTSW 14 51162689 missense probably damaging 1.00
R1466:Rnase2b UTSW 14 51162839 nonsense probably null
R1466:Rnase2b UTSW 14 51162839 nonsense probably null
R1912:Rnase2b UTSW 14 51162900 missense probably damaging 1.00
R2009:Rnase2b UTSW 14 51162890 missense possibly damaging 0.69
R2307:Rnase2b UTSW 14 51162731 missense probably benign 0.00
R3849:Rnase2b UTSW 14 51162748 missense probably damaging 1.00
R4717:Rnase2b UTSW 14 51162717 missense possibly damaging 0.65
R4994:Rnase2b UTSW 14 51162751 missense possibly damaging 0.53
R7167:Rnase2b UTSW 14 51162765 missense probably damaging 1.00
R8919:Rnase2b UTSW 14 51162890 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGTCTCATGCCAGCGACCAAC -3'
(R):5'- GCACTGGAGCTAAAATAGCCGATCC -3'

Sequencing Primer
(F):5'- AACCCCTTCCCAGAAGTTTG -3'
(R):5'- CTGGGGTTACAGGCAACTG -3'
Posted On2014-02-11