ID | 156232 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Symbol | Slc52a2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ensembl Gene | ENSMUSG00000022560 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | solute carrier protein 52, member 2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | PAR2, Gpr172b, GPCR42, 2010003P03Rik, D15Ertd747e, Rfvt2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 039423-MU | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Numbers | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Essential gene? | Essential (E-score: 1.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stock # | R1358 (G1) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Quality Score | 193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Status | Not validated | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 15 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 76423032-76428808 bp(+) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Type of Mutation | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA Base Change (assembly) | G to A at 76424269 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Zygosity | Heterozygous | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Arginine to Histidine at position 169 (R169H) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ref Sequence | ENSEMBL: ENSMUSP00000023220 (fasta) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9D8F3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000023219 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000023219 Gene: ENSMUSG00000022559
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000023220 AA Change: R169H PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000023220 Gene: ENSMUSG00000022560 AA Change: R169H
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000228994 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000229074 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000229273 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000229813 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000230513 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000230938 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000230994 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coding Region Coverage |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Validation Efficiency | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype | FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein which belongs to the riboflavin transporter family. In humans, riboflavin must be obtained by intestinal absorption because it cannot be synthesized by the body. The water-soluble vitamin riboflavin is processed to the coenzymes flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) which then act as intermediaries in many cellular metabolic reactions. Paralogous members of the riboflavin transporter gene family are located on chromosomes 17 and 20. Unlike other members of this family, this gene has higher expression in brain tissue than small intestine. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. Mutations in this gene have been associated with Brown-Vialetto-Van Laere syndrome 2 - an autosomal recessive progressive neurologic disorder characterized by deafness, bulbar dysfunction, and axial and limb hypotonia. [provided by RefSeq, Jul 2012] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allele List at MGI | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in this stock |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in Slc52a2 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Primers |
PCR Primer (F):5'- AGTCCCCATCCGAGTGGTTCAG -3' (R):5'- TCTACCCGAAGCCCTGTACCTG -3' Sequencing Primer (F):5'- TGGCAGGAAAGCCGTACTC -3' (R):5'- AAGCCCTGTACCTGTTGTG -3' |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Posted On | 2014-02-11 |