Incidental Mutation 'R1354:Ccdc183'
ID156234
Institutional Source Beutler Lab
Gene Symbol Ccdc183
Ensembl Gene ENSMUSG00000026940
Gene Namecoiled-coil domain containing 183
SynonymsCccd183, 4921530D09Rik
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25608635-25617678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25612139 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 241 (N241S)
Ref Sequence ENSEMBL: ENSMUSP00000028309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028309] [ENSMUST00000058137]
Predicted Effect probably benign
Transcript: ENSMUST00000028309
AA Change: N241S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028309
Gene: ENSMUSG00000026940
AA Change: N241S

DomainStartEndE-ValueType
coiled coil region 118 147 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
coiled coil region 321 406 N/A INTRINSIC
low complexity region 524 534 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058137
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155684
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Ccdc183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ccdc183 APN 2 25609771 missense probably benign 0.01
IGL02177:Ccdc183 APN 2 25612083 missense probably benign 0.03
R1547:Ccdc183 UTSW 2 25609350 missense probably benign 0.05
R5084:Ccdc183 UTSW 2 25608790 missense probably damaging 0.97
R5579:Ccdc183 UTSW 2 25615422 missense possibly damaging 0.92
R6188:Ccdc183 UTSW 2 25609752 missense probably benign 0.28
R6224:Ccdc183 UTSW 2 25610582 missense possibly damaging 0.55
R6372:Ccdc183 UTSW 2 25616164 missense probably benign 0.21
R6994:Ccdc183 UTSW 2 25617045 missense probably benign 0.00
R7041:Ccdc183 UTSW 2 25613670 missense probably benign 0.00
R7132:Ccdc183 UTSW 2 25616530 critical splice donor site probably null
R7177:Ccdc183 UTSW 2 25616284 missense probably damaging 1.00
R7432:Ccdc183 UTSW 2 25609457 missense probably benign
R7561:Ccdc183 UTSW 2 25611517 missense probably benign 0.00
R8283:Ccdc183 UTSW 2 25612148 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGATTGGAGGGGAAATCCAAGTCC -3'
(R):5'- AAAGCCACAGCATGTGTCAGCC -3'

Sequencing Primer
(F):5'- GGGAAATCCAAGTCCCTCCG -3'
(R):5'- CATGTGTCAGCCAGGAGTC -3'
Posted On2014-02-11