Incidental Mutation 'R1354:Atoh1'
ID156241
Institutional Source Beutler Lab
Gene Symbol Atoh1
Ensembl Gene ENSMUSG00000073043
Gene Nameatonal bHLH transcription factor 1
SynonymsbHLHa14, Hath1, Math1
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1354 (G1)
Quality Score182
Status Not validated
Chromosome6
Chromosomal Location64729125-64731245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64729357 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 12 (E12G)
Ref Sequence ENSEMBL: ENSMUSP00000098903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101351
AA Change: E12G

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098903
Gene: ENSMUSG00000073043
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
HLH 162 214 1.1e-20 SMART
low complexity region 243 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the basic helix-loop-helix (BHLH) family of transcription factors. It activates E-box dependent transcription along with E47. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a decreased cerebellum without folia, and lack cerebellar granule neurons, inner-ear hair cells, D1 interneurons, and goblet, enteroendocrine, and Paneth cells. Mutants fail to breathe properly and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Atoh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Atoh1 APN 6 64729584 missense possibly damaging 0.54
IGL02126:Atoh1 APN 6 64729350 missense probably damaging 1.00
R1674:Atoh1 UTSW 6 64729930 missense possibly damaging 0.88
R1675:Atoh1 UTSW 6 64730157 missense probably benign 0.01
R1895:Atoh1 UTSW 6 64729459 missense probably benign 0.01
R1946:Atoh1 UTSW 6 64729459 missense probably benign 0.01
R1988:Atoh1 UTSW 6 64729633 missense probably benign 0.04
R2566:Atoh1 UTSW 6 64729684 missense probably damaging 1.00
R3730:Atoh1 UTSW 6 64729573 missense probably benign 0.00
R3893:Atoh1 UTSW 6 64730133 missense probably damaging 1.00
R4241:Atoh1 UTSW 6 64729774 missense probably damaging 1.00
R7411:Atoh1 UTSW 6 64729930 missense probably damaging 1.00
R7749:Atoh1 UTSW 6 64729920 missense possibly damaging 0.89
R8196:Atoh1 UTSW 6 64730242 missense probably benign 0.00
R8289:Atoh1 UTSW 6 64729909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAGTCGAATTACAGCCCCAC -3'
(R):5'- CTCGGGAGAATGCAGCAGATACTG -3'

Sequencing Primer
(F):5'- ttctttttttttttttttCCAGAGCC -3'
(R):5'- AGCAGATACTGGGCGGC -3'
Posted On2014-02-11