Incidental Mutation 'R1354:Edem1'
ID156242
Institutional Source Beutler Lab
Gene Symbol Edem1
Ensembl Gene ENSMUSG00000030104
Gene NameER degradation enhancer, mannosidase alpha-like 1
SynonymsA130059K23Rik
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location108828641-108859356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108854316 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 579 (I579M)
Ref Sequence ENSEMBL: ENSMUSP00000086565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089162] [ENSMUST00000204804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089162
AA Change: I579M

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086565
Gene: ENSMUSG00000030104
AA Change: I579M

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 581 1.1e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204524
Predicted Effect probably benign
Transcript: ENSMUST00000204804
SMART Domains Protein: ENSMUSP00000144901
Gene: ENSMUSG00000030104

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 529 9.9e-97 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Edem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Edem1 APN 6 108855559 utr 3 prime probably benign
IGL00648:Edem1 APN 6 108851207 splice site probably null
IGL00694:Edem1 APN 6 108841601 missense possibly damaging 0.95
IGL02231:Edem1 APN 6 108828888 missense probably benign 0.06
IGL02967:Edem1 APN 6 108836777 missense probably damaging 1.00
IGL03018:Edem1 APN 6 108829142 missense probably damaging 0.98
PIT4468001:Edem1 UTSW 6 108844867 missense probably damaging 0.98
R0050:Edem1 UTSW 6 108828848 missense possibly damaging 0.91
R0367:Edem1 UTSW 6 108846752 missense probably damaging 1.00
R1165:Edem1 UTSW 6 108851253 missense probably damaging 1.00
R1385:Edem1 UTSW 6 108846684 missense probably damaging 1.00
R1588:Edem1 UTSW 6 108841679 missense probably damaging 1.00
R1964:Edem1 UTSW 6 108844947 missense probably benign 0.03
R2060:Edem1 UTSW 6 108854287 missense probably damaging 0.99
R2106:Edem1 UTSW 6 108848725 missense probably damaging 0.98
R2393:Edem1 UTSW 6 108852543 missense probably damaging 1.00
R2443:Edem1 UTSW 6 108851269 missense probably benign 0.13
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3733:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3734:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R4754:Edem1 UTSW 6 108841697 missense probably damaging 1.00
R4791:Edem1 UTSW 6 108841634 missense probably damaging 1.00
R4792:Edem1 UTSW 6 108828746 unclassified probably benign
R5326:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5334:Edem1 UTSW 6 108848832 critical splice donor site probably null
R5501:Edem1 UTSW 6 108843100 critical splice donor site probably null
R5542:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5976:Edem1 UTSW 6 108842962 missense probably damaging 0.99
R6177:Edem1 UTSW 6 108851198 splice site probably null
R6556:Edem1 UTSW 6 108854357 missense probably benign 0.00
R6835:Edem1 UTSW 6 108854399 missense probably benign 0.00
R7192:Edem1 UTSW 6 108829004 missense probably benign 0.00
R7239:Edem1 UTSW 6 108854380 missense probably benign
R7442:Edem1 UTSW 6 108851305 nonsense probably null
R7780:Edem1 UTSW 6 108841628 missense probably benign 0.00
R7902:Edem1 UTSW 6 108854377 missense possibly damaging 0.88
R8103:Edem1 UTSW 6 108852563 missense probably damaging 1.00
R8135:Edem1 UTSW 6 108829061 nonsense probably null
R8359:Edem1 UTSW 6 108846813 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TAGAGCTGTATGCCAGCCCTAGAC -3'
(R):5'- GCCAAGACTGATGTGCCTATACTGC -3'

Sequencing Primer
(F):5'- cctccccttccctcccc -3'
(R):5'- tcaaagtttacaatctgagtatgcc -3'
Posted On2014-02-11