Incidental Mutation 'R1354:Megf11'
ID156245
Institutional Source Beutler Lab
Gene Symbol Megf11
Ensembl Gene ENSMUSG00000036466
Gene Namemultiple EGF-like-domains 11
Synonyms
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R1354 (G1)
Quality Score110
Status Not validated
Chromosome9
Chromosomal Location64385626-64709205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64653177 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 335 (E335G)
Ref Sequence ENSEMBL: ENSMUSP00000114035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068967] [ENSMUST00000093829] [ENSMUST00000118485] [ENSMUST00000164113]
Predicted Effect probably benign
Transcript: ENSMUST00000068967
AA Change: E335G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065353
Gene: ENSMUSG00000036466
AA Change: E335G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093829
AA Change: E304G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091349
Gene: ENSMUSG00000036466
AA Change: E304G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF_Lam 114 153 9.55e-3 SMART
EGF_Lam 157 196 2e-5 SMART
EGF 195 227 5.57e-4 SMART
EGF_Lam 243 282 1.26e-2 SMART
EGF_Lam 286 326 2.52e-2 SMART
EGF_Lam 330 371 4.16e-3 SMART
EGF 370 402 6.21e-2 SMART
EGF 413 445 4.1e-2 SMART
EGF 456 488 7.02e-1 SMART
EGF_Lam 504 543 1.43e-1 SMART
EGF_Lam 547 586 5.04e-2 SMART
EGF 585 619 8.52e0 SMART
EGF 630 662 9.41e-2 SMART
EGF_Lam 678 717 2.99e-4 SMART
EGF 716 748 1.14e0 SMART
transmembrane domain 774 796 N/A INTRINSIC
low complexity region 821 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118485
AA Change: E335G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114035
Gene: ENSMUSG00000036466
AA Change: E335G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 926 941 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148449
Predicted Effect probably benign
Transcript: ENSMUST00000164113
AA Change: E335G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128672
Gene: ENSMUSG00000036466
AA Change: E335G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF_Lam 709 748 2.99e-4 SMART
EGF 747 779 1.14e0 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of horizontal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Megf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Megf11 APN 9 64508727 missense probably damaging 1.00
IGL01285:Megf11 APN 9 64660446 missense probably damaging 1.00
IGL01309:Megf11 APN 9 64681416 missense probably benign 0.01
IGL01953:Megf11 APN 9 64690088 missense probably damaging 1.00
IGL02341:Megf11 APN 9 64544620 missense probably damaging 1.00
IGL02407:Megf11 APN 9 64680249 missense probably damaging 1.00
IGL02621:Megf11 APN 9 64693932 missense probably benign 0.07
R0277:Megf11 UTSW 9 64691350 critical splice donor site probably null
R0386:Megf11 UTSW 9 64640078 missense probably damaging 1.00
R1709:Megf11 UTSW 9 64695412 missense probably damaging 1.00
R1865:Megf11 UTSW 9 64680299 missense probably benign 0.39
R1895:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R1946:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R2221:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R2223:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R3552:Megf11 UTSW 9 64695463 missense possibly damaging 0.75
R4641:Megf11 UTSW 9 64690125 missense possibly damaging 0.93
R4746:Megf11 UTSW 9 64508745 missense probably damaging 1.00
R5594:Megf11 UTSW 9 64686473 missense probably damaging 1.00
R5716:Megf11 UTSW 9 64506110 missense possibly damaging 0.72
R5898:Megf11 UTSW 9 64685964 missense probably damaging 1.00
R5960:Megf11 UTSW 9 64660449 missense probably benign 0.00
R6372:Megf11 UTSW 9 64706625 missense probably damaging 1.00
R6811:Megf11 UTSW 9 64544641 missense probably damaging 0.99
R6868:Megf11 UTSW 9 64680309 missense probably damaging 1.00
R6980:Megf11 UTSW 9 64705850 missense probably damaging 1.00
R6984:Megf11 UTSW 9 64686452 missense probably benign
R7155:Megf11 UTSW 9 64647951 missense probably null 1.00
R7638:Megf11 UTSW 9 64679253 missense probably damaging 0.96
R7643:Megf11 UTSW 9 64706632 missense probably damaging 1.00
R7688:Megf11 UTSW 9 64691864 missense possibly damaging 0.92
R7840:Megf11 UTSW 9 64695427 missense possibly damaging 0.94
V5088:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
Z1088:Megf11 UTSW 9 64660476 missense probably damaging 1.00
Z1177:Megf11 UTSW 9 64680326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATGCAGATGCAGCAAATAGCCC -3'
(R):5'- AGCCCAGTAGCTGAACATGAAGAAC -3'

Sequencing Primer
(F):5'- AGCAAATAGCCCAGCAAGG -3'
(R):5'- GCAGGTGACCTAAGGTCTGG -3'
Posted On2014-02-11