Incidental Mutation 'R1354:Glod4'
ID156247
Institutional Source Beutler Lab
Gene Symbol Glod4
Ensembl Gene ENSMUSG00000017286
Gene Nameglyoxalase domain containing 4
Synonyms1700082G03Rik, 2700085E05Rik
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location76120987-76243725 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 76237828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017430] [ENSMUST00000168055] [ENSMUST00000168055] [ENSMUST00000169701] [ENSMUST00000169701] [ENSMUST00000170017] [ENSMUST00000170590] [ENSMUST00000170710]
Predicted Effect probably null
Transcript: ENSMUST00000017430
SMART Domains Protein: ENSMUSP00000017430
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 1.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164022
SMART Domains Protein: ENSMUSP00000126699
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 212 1e-143 PDB
SCOP:d1mpya1 119 198 4e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164022
SMART Domains Protein: ENSMUSP00000126699
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 212 1e-143 PDB
SCOP:d1mpya1 119 198 4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167883
Predicted Effect probably null
Transcript: ENSMUST00000168055
SMART Domains Protein: ENSMUSP00000130675
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 98 3e-61 PDB
Predicted Effect probably null
Transcript: ENSMUST00000168055
SMART Domains Protein: ENSMUSP00000130675
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 98 3e-61 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably null
Transcript: ENSMUST00000169701
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169701
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170017
SMART Domains Protein: ENSMUSP00000132496
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
SCOP:d1qipa_ 1 40 3e-5 SMART
PDB:3ZI1|A 1 47 4e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000170590
SMART Domains Protein: ENSMUSP00000129009
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 1 47 2e-23 PDB
SCOP:d1mpya2 1 66 1e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170710
SMART Domains Protein: ENSMUSP00000131788
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 124 237 6.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Glod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Glod4 APN 11 76233278 missense probably benign 0.08
IGL01099:Glod4 APN 11 76239550 nonsense probably null
IGL01761:Glod4 APN 11 76243602 missense probably benign 0.00
FR4548:Glod4 UTSW 11 76243310 start gained probably benign
R1386:Glod4 UTSW 11 76222003 nonsense probably null
R1791:Glod4 UTSW 11 76237708 missense probably damaging 1.00
R2281:Glod4 UTSW 11 76237809 missense possibly damaging 0.74
R2484:Glod4 UTSW 11 76239518 missense probably damaging 1.00
R4515:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R4517:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R4519:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R5945:Glod4 UTSW 11 76234471 missense probably damaging 1.00
R6471:Glod4 UTSW 11 76233918 missense probably damaging 1.00
R6488:Glod4 UTSW 11 76237785 missense probably damaging 0.96
R6976:Glod4 UTSW 11 76243580 missense probably damaging 1.00
R8263:Glod4 UTSW 11 76234492 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAGGCTTTGCCTGGCCTATTGTA -3'
(R):5'- AGTGGATAGCTGACCAGTCCATGT -3'

Sequencing Primer
(F):5'- AGTTACCTGACTGAGATGGGC -3'
(R):5'- accactgagccatttctcc -3'
Posted On2014-02-11