Incidental Mutation 'R1354:Wdr45b'
ID156248
Institutional Source Beutler Lab
Gene Symbol Wdr45b
Ensembl Gene ENSMUSG00000025173
Gene NameWD repeat domain 45B
SynonymsD16Bwg0193e, 0610008N23Rik, Wdr45l
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location121327224-121354445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121335430 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 191 (I191N)
Ref Sequence ENSEMBL: ENSMUSP00000026173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026173] [ENSMUST00000106110] [ENSMUST00000136797]
Predicted Effect probably damaging
Transcript: ENSMUST00000026173
AA Change: I191N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026173
Gene: ENSMUSG00000025173
AA Change: I191N

DomainStartEndE-ValueType
Blast:WD40 11 37 2e-9 BLAST
low complexity region 70 79 N/A INTRINSIC
Blast:WD40 89 124 6e-11 BLAST
Blast:WD40 128 170 1e-5 BLAST
WD40 174 214 1.38e-2 SMART
WD40 217 258 3.71e-1 SMART
low complexity region 278 289 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106110
AA Change: I191N

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101716
Gene: ENSMUSG00000025173
AA Change: I191N

DomainStartEndE-ValueType
PDB:4EXV|A 3 205 9e-16 PDB
Blast:WD40 9 37 7e-11 BLAST
SCOP:d1tbga_ 9 205 6e-10 SMART
Blast:WD40 89 124 2e-11 BLAST
Blast:WD40 128 170 2e-6 BLAST
Blast:WD40 174 210 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136797
AA Change: I157N

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119591
Gene: ENSMUSG00000025173
AA Change: I157N

DomainStartEndE-ValueType
PDB:4EXV|A 3 171 1e-9 PDB
Blast:WD40 9 37 2e-11 BLAST
SCOP:d1tbga_ 18 171 6e-8 SMART
Blast:WD40 55 90 6e-12 BLAST
Blast:WD40 94 136 1e-6 BLAST
Blast:WD40 140 172 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137230
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WIPI or SVP1 family of WD40 repeat-containing proteins. The protein contains seven WD40 repeats that are thought to fold into a beta-propeller structure that mediates protein-protein interactions, and a conserved motif for interaction with phospholipids. The human genome contains several pseudogenes of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Other mutations in Wdr45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02532:Wdr45b APN 11 121328813 missense probably benign 0.00
R0930:Wdr45b UTSW 11 121330214 missense probably damaging 1.00
R1600:Wdr45b UTSW 11 121330189 missense probably damaging 0.99
R4969:Wdr45b UTSW 11 121328824 nonsense probably null
R5133:Wdr45b UTSW 11 121328795 missense probably benign 0.06
R5850:Wdr45b UTSW 11 121331097 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCAGGTGTGAAAGATACTTCTGACG -3'
(R):5'- GCGGGAATCAGGCTTTGACCATTG -3'

Sequencing Primer
(F):5'- GACTAAGGTACTAAGTGGTCTTGAAC -3'
(R):5'- GAATCAGGCTTTGACCATTGTCATC -3'
Posted On2014-02-11