Incidental Mutation 'R1354:Ndst2'
ID156252
Institutional Source Beutler Lab
Gene Symbol Ndst2
Ensembl Gene ENSMUSG00000039308
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms[Heparan sulfate]-glucosamine N-sulfotransferase, glucosaminyl N-deacetylase/N-sulphotransferase-2, Mndns
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20723730-20734562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20724975 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 749 (R749L)
Ref Sequence ENSEMBL: ENSMUSP00000153141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000047490] [ENSMUST00000223679] [ENSMUST00000223840] [ENSMUST00000224751] [ENSMUST00000225000] [ENSMUST00000225419]
Predicted Effect probably benign
Transcript: ENSMUST00000022358
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047490
AA Change: R749L

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040227
Gene: ENSMUSG00000039308
AA Change: R749L

DomainStartEndE-ValueType
Pfam:HSNSD 25 514 9.1e-245 PFAM
Pfam:Sulfotransfer_1 603 866 9.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223561
Predicted Effect possibly damaging
Transcript: ENSMUST00000223679
AA Change: R749L

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably benign
Transcript: ENSMUST00000223840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224234
Predicted Effect probably benign
Transcript: ENSMUST00000224751
Predicted Effect unknown
Transcript: ENSMUST00000224829
AA Change: R97L
Predicted Effect possibly damaging
Transcript: ENSMUST00000225000
AA Change: R749L

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225320
Predicted Effect probably benign
Transcript: ENSMUST00000225911
Predicted Effect probably benign
Transcript: ENSMUST00000225419
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-deacetylase/N-sulfotransferase subfamily of the sulfotransferase 1 proteins. The encoded enzyme has dual functions in processing glucosamine and heparin polymers, including N-deacetylation and N-sulfation. The encoded protein may be localized to the Golgi. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozugous for a null allele exhibit reduced mast cell numbers, histamine storage, protease storage and degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Ndst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ndst2 APN 14 20724484 missense probably benign 0.11
IGL00650:Ndst2 APN 14 20729668 missense possibly damaging 0.77
IGL01565:Ndst2 APN 14 20728206 missense probably damaging 0.98
IGL01746:Ndst2 APN 14 20729414 missense probably benign 0.02
IGL02457:Ndst2 APN 14 20729554 missense possibly damaging 0.95
IGL03193:Ndst2 APN 14 20729849 missense probably damaging 0.97
IGL03238:Ndst2 APN 14 20728504 missense probably damaging 1.00
IGL03277:Ndst2 APN 14 20730166 missense possibly damaging 0.92
R0090:Ndst2 UTSW 14 20727267 missense probably damaging 0.98
R0481:Ndst2 UTSW 14 20724468 missense possibly damaging 0.70
R0677:Ndst2 UTSW 14 20729579 missense probably benign 0.06
R0834:Ndst2 UTSW 14 20729693 missense probably damaging 1.00
R1015:Ndst2 UTSW 14 20730064 missense probably damaging 1.00
R1678:Ndst2 UTSW 14 20724514 missense probably benign 0.00
R2680:Ndst2 UTSW 14 20724754 missense probably damaging 0.99
R2853:Ndst2 UTSW 14 20729896 missense probably damaging 1.00
R5000:Ndst2 UTSW 14 20724907 critical splice donor site probably null
R5266:Ndst2 UTSW 14 20724487 missense probably damaging 1.00
R6737:Ndst2 UTSW 14 20727494 missense probably damaging 1.00
R7109:Ndst2 UTSW 14 20729843 missense probably damaging 1.00
R7506:Ndst2 UTSW 14 20730085 missense probably benign
R7646:Ndst2 UTSW 14 20724459 critical splice donor site probably null
R8094:Ndst2 UTSW 14 20728164 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCCTGGCACCAAAATCCTTTATC -3'
(R):5'- CCAGAGCCATTGTCAAATGAGCACC -3'

Sequencing Primer
(F):5'- TGATACCCAGGAACTTCTGGATG -3'
(R):5'- CATTGTCAAATGAGCACCTTATCC -3'
Posted On2014-02-11