Incidental Mutation 'R1354:Rtl6'
ID156254
Institutional Source Beutler Lab
Gene Symbol Rtl6
Ensembl Gene ENSMUSG00000055745
Gene Nameretrotransposon Gag like 6
SynonymsLdoc1l, Mar6, Mart6
MMRRC Submission 039419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location84553398-84557823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84556527 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 223 (V223M)
Ref Sequence ENSEMBL: ENSMUSP00000069947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069476]
Predicted Effect probably damaging
Transcript: ENSMUST00000069476
AA Change: V223M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069947
Gene: ENSMUSG00000055745
AA Change: V223M

DomainStartEndE-ValueType
coiled coil region 29 72 N/A INTRINSIC
Pfam:DUF4939 78 180 5e-25 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Tbc1d9 A C 8: 83,268,981 probably null Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Rtl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4080:Rtl6 UTSW 15 84557001 missense possibly damaging 0.77
R4276:Rtl6 UTSW 15 84557196 start gained probably benign
R6294:Rtl6 UTSW 15 84557120 missense possibly damaging 0.59
R7352:Rtl6 UTSW 15 84556980 missense possibly damaging 0.77
Z1177:Rtl6 UTSW 15 84556478 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACCAATGCCGATGACAGGATG -3'
(R):5'- AGGGTTCCTGATGCAGATGGACAG -3'

Sequencing Primer
(F):5'- TGACAGGATGGTCTCCCGTAG -3'
(R):5'- AGAGTGGCCTTCCTGGTATCC -3'
Posted On2014-02-11