Mutagenetix > Incidental Mutations

Incidental Mutation 'R1355:Uckl1'

156263

Institutional Source

Beutler Lab

Gene Symbol

Uckl1

Ensembl Gene

ENSMUSG00000089917

Gene Name

uridine-cytidine kinase 1-like 1

Synonyms

Urkl1, 1110007H10Rik

MMRRC Submission

039420-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R1355 (G1)

Quality Score

197

Status

Validated

Chromosome

Chromosomal Location

181569149-181584892 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 181573376 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 213 (T213K)

Ref Sequence

ENSEMBL: ENSMUSP00000114821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]

Predicted Effect

probably damaging
Transcript: ENSMUST00000057816
AA Change: T228K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: T228K

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:CPT	98	249	7e-10	PFAM
Pfam:PRK	100	288	5.7e-61	PFAM
Pfam:UPRTase	326	532	2.6e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124315

Predicted Effect

probably damaging
Transcript: ENSMUST00000129469
AA Change: T228K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917
AA Change: T228K

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:CPT	98	210	5.1e-10	PFAM
Pfam:AAA_17	100	251	1.1e-8	PFAM
Pfam:PRK	100	288	3.4e-60	PFAM
Pfam:AAA_18	101	257	5.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130893

Predicted Effect

probably benign
Transcript: ENSMUST00000131949

Predicted Effect

probably benign
Transcript: ENSMUST00000134340

SMART Domains

Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917

Domain	Start	End	E-Value	Type
Pfam:UPRTase	1	182	9.8e-63	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000136875
AA Change: T213K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917
AA Change: T213K

Domain	Start	End	E-Value	Type
Pfam:CPT	83	211	2.3e-10	PFAM
Pfam:AAA_17	85	235	4.9e-9	PFAM
Pfam:PRK	85	235	8.4e-47	PFAM
Pfam:AAA_18	86	235	2.7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136997

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142491

Predicted Effect

unknown
Transcript: ENSMUST00000144856
AA Change: T212K

SMART Domains

Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917
AA Change: T212K

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC
Pfam:CPT	83	211	2.7e-10	PFAM
Pfam:PRK	85	253	7.7e-56	PFAM
Pfam:AAA_17	86	240	2.5e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155182

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156308

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156998

Predicted Effect

probably benign
Transcript: ENSMUST00000154613

Meta Mutation Damage Score

0.9443

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
B4galnt4	T	C	7: 141,065,395	V259A	probably damaging	Het
Ccdc141	A	T	2: 77,030,601	I944N	probably damaging	Het
Ccdc146	A	T	5: 21,321,242	D224E	probably damaging	Het
Ccne1	A	G	7: 38,106,322	I43T	possibly damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cebpz	G	T	17: 78,935,324	D300E	probably benign	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dpy19l4	C	T	4: 11,303,371	W183*	probably null	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Erc1	A	T	6: 119,743,420	L440*	probably null	Het
Fam71e1	A	G	7: 44,496,691	K2E	possibly damaging	Het
Frem3	A	G	8: 80,690,702	Y2012C	probably damaging	Het
Gm10288	A	T	3: 146,838,993		noncoding transcript	Het
Gm1110	T	A	9: 26,883,761	K476N	probably benign	Het
Gm11937	A	T	11: 99,609,907	S95T	possibly damaging	Het
Hist1h2bl	T	A	13: 21,715,857	Q96L	probably damaging	Het
Hs6st1	T	A	1: 36,103,576	H197Q	probably damaging	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Nlrp2	G	T	7: 5,327,491	N635K	possibly damaging	Het
Olfr140	G	A	2: 90,051,613	T237I	probably benign	Het
Olfr1466	T	A	19: 13,342,518	Y253*	probably null	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Plxna1	A	G	6: 89,320,766		probably benign	Het
Ppp4r1	A	T	17: 65,840,987	E924D	probably benign	Het
Prdm2	C	T	4: 143,131,963	V1586I	probably benign	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rgs16	A	T	1: 153,743,668	K140M	probably damaging	Het
Rgsl1	A	G	1: 153,807,761	M1T	probably null	Het
Setdb2	T	A	14: 59,417,441	K333N	probably damaging	Het
Sgo2a	A	G	1: 58,017,965	T1103A	possibly damaging	Het
Sik3	C	T	9: 46,195,872		probably benign	Het
Slc44a3	C	A	3: 121,531,671	G47V	probably damaging	Het
Snrpd1	G	A	18: 10,627,818	G103D	probably benign	Het
Soga3	A	T	10: 29,147,322	T222S	probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Susd1	C	T	4: 59,424,114	C37Y	possibly damaging	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Usp38	T	C	8: 80,985,033	E791G	possibly damaging	Het
Vps13b	C	T	15: 35,422,454	R187C	probably damaging	Het
Vwa3a	A	G	7: 120,784,111	Y645C	probably damaging	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het

Other mutations in Uckl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Uckl1	APN	2	181569617	missense	probably benign	0.09
IGL01128:Uckl1	APN	2	181570337	missense	probably damaging	1.00
IGL01325:Uckl1	APN	2	181574961	nonsense	probably null
IGL01767:Uckl1	APN	2	181569534	missense	probably damaging	1.00
IGL02260:Uckl1	APN	2	181569588	missense	probably damaging	1.00
IGL02390:Uckl1	APN	2	181574419	missense	possibly damaging	0.59
IGL03369:Uckl1	APN	2	181570189	missense	probably benign	0.00
R0001:Uckl1	UTSW	2	181574655	missense	probably damaging	1.00
R0528:Uckl1	UTSW	2	181570490	splice site	probably benign
R1037:Uckl1	UTSW	2	181572485	missense	possibly damaging	0.67
R1416:Uckl1	UTSW	2	181569569	missense	possibly damaging	0.79
R1435:Uckl1	UTSW	2	181573133	missense	probably benign	0.01
R1676:Uckl1	UTSW	2	181574918	missense	probably damaging	1.00
R1723:Uckl1	UTSW	2	181570600	critical splice acceptor site	probably null
R1954:Uckl1	UTSW	2	181570527	missense	probably benign	0.17
R1955:Uckl1	UTSW	2	181570527	missense	probably benign	0.17
R3972:Uckl1	UTSW	2	181574463	missense	probably damaging	0.98
R4664:Uckl1	UTSW	2	181574868	missense	possibly damaging	0.91
R4666:Uckl1	UTSW	2	181574868	missense	possibly damaging	0.91
R5306:Uckl1	UTSW	2	181574367	critical splice donor site	probably null
R5751:Uckl1	UTSW	2	181574452	missense	possibly damaging	0.81
R5758:Uckl1	UTSW	2	181569953	missense	probably damaging	1.00
R6174:Uckl1	UTSW	2	181573073	critical splice donor site	probably null
R6662:Uckl1	UTSW	2	181573260	missense	possibly damaging	0.87
R6865:Uckl1	UTSW	2	181574493	missense	probably damaging	1.00
R7051:Uckl1	UTSW	2	181574244	missense	probably damaging	1.00
R7643:Uckl1	UTSW	2	181573106	missense	probably benign	0.08
R7818:Uckl1	UTSW	2	181574667	missense	probably damaging	0.97
R8094:Uckl1	UTSW	2	181573256	missense	probably damaging	1.00
R8341:Uckl1	UTSW	2	181569719	missense	probably benign	0.00
R8515:Uckl1	UTSW	2	181574487	missense	probably damaging	1.00
RF014:Uckl1	UTSW	2	181570194	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCTGGCTAACTAACCTCTTCCAGC -3'
(R):5'- TTGTGCCCCTGACTAGTAGTAGTCC -3'

Sequencing Primer
(F):5'- CAATCAGGTCAATGGCTACTGTG -3'
(R):5'- TAAACCAATGGATGCCTTGTGG -3'

Posted On

2014-02-11