Incidental Mutation 'R1355:Uckl1'
ID156263
Institutional Source Beutler Lab
Gene Symbol Uckl1
Ensembl Gene ENSMUSG00000089917
Gene Nameuridine-cytidine kinase 1-like 1
SynonymsUrkl1, 1110007H10Rik
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R1355 (G1)
Quality Score197
Status Validated
Chromosome2
Chromosomal Location181569149-181584892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 181573376 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 213 (T213K)
Ref Sequence ENSEMBL: ENSMUSP00000114821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]
Predicted Effect probably damaging
Transcript: ENSMUST00000057816
AA Change: T228K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: T228K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124315
Predicted Effect probably damaging
Transcript: ENSMUST00000129469
AA Change: T228K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917
AA Change: T228K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130893
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect probably benign
Transcript: ENSMUST00000134340
SMART Domains Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:UPRTase 1 182 9.8e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136875
AA Change: T213K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917
AA Change: T213K

DomainStartEndE-ValueType
Pfam:CPT 83 211 2.3e-10 PFAM
Pfam:AAA_17 85 235 4.9e-9 PFAM
Pfam:PRK 85 235 8.4e-47 PFAM
Pfam:AAA_18 86 235 2.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142491
Predicted Effect unknown
Transcript: ENSMUST00000144856
AA Change: T212K
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917
AA Change: T212K

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156998
Predicted Effect probably benign
Transcript: ENSMUST00000154613
Meta Mutation Damage Score 0.9443 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Uckl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Uckl1 APN 2 181569617 missense probably benign 0.09
IGL01128:Uckl1 APN 2 181570337 missense probably damaging 1.00
IGL01325:Uckl1 APN 2 181574961 nonsense probably null
IGL01767:Uckl1 APN 2 181569534 missense probably damaging 1.00
IGL02260:Uckl1 APN 2 181569588 missense probably damaging 1.00
IGL02390:Uckl1 APN 2 181574419 missense possibly damaging 0.59
IGL03369:Uckl1 APN 2 181570189 missense probably benign 0.00
R0001:Uckl1 UTSW 2 181574655 missense probably damaging 1.00
R0528:Uckl1 UTSW 2 181570490 splice site probably benign
R1037:Uckl1 UTSW 2 181572485 missense possibly damaging 0.67
R1416:Uckl1 UTSW 2 181569569 missense possibly damaging 0.79
R1435:Uckl1 UTSW 2 181573133 missense probably benign 0.01
R1676:Uckl1 UTSW 2 181574918 missense probably damaging 1.00
R1723:Uckl1 UTSW 2 181570600 critical splice acceptor site probably null
R1954:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R1955:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R3972:Uckl1 UTSW 2 181574463 missense probably damaging 0.98
R4664:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R4666:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R5306:Uckl1 UTSW 2 181574367 critical splice donor site probably null
R5751:Uckl1 UTSW 2 181574452 missense possibly damaging 0.81
R5758:Uckl1 UTSW 2 181569953 missense probably damaging 1.00
R6174:Uckl1 UTSW 2 181573073 critical splice donor site probably null
R6662:Uckl1 UTSW 2 181573260 missense possibly damaging 0.87
R6865:Uckl1 UTSW 2 181574493 missense probably damaging 1.00
R7051:Uckl1 UTSW 2 181574244 missense probably damaging 1.00
R7643:Uckl1 UTSW 2 181573106 missense probably benign 0.08
R7818:Uckl1 UTSW 2 181574667 missense probably damaging 0.97
R8094:Uckl1 UTSW 2 181573256 missense probably damaging 1.00
R8341:Uckl1 UTSW 2 181569719 missense probably benign 0.00
R8515:Uckl1 UTSW 2 181574487 missense probably damaging 1.00
RF014:Uckl1 UTSW 2 181570194 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGGCTAACTAACCTCTTCCAGC -3'
(R):5'- TTGTGCCCCTGACTAGTAGTAGTCC -3'

Sequencing Primer
(F):5'- CAATCAGGTCAATGGCTACTGTG -3'
(R):5'- TAAACCAATGGATGCCTTGTGG -3'
Posted On2014-02-11