Incidental Mutation 'R1355:Slc44a3'
ID156265
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Namesolute carrier family 44, member 3
Synonyms
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1355 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121459528-121532404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121531671 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 47 (G47V)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
Predicted Effect probably damaging
Transcript: ENSMUST00000039197
AA Change: G47V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: G47V

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199889
Meta Mutation Damage Score 0.4756 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTGCTGCAAGCTGTGATTC -3'
(R):5'- TGACACAAGTGTTGGGCTGAGG -3'

Sequencing Primer
(F):5'- CAATAAATCTTGGTCTCCGGCAG -3'
(R):5'- GAGCTGATCTTCCCCAGTGATAG -3'
Posted On2014-02-11