Incidental Mutation 'R1355:Dpy19l4'
ID 156267
Institutional Source Beutler Lab
Gene Symbol Dpy19l4
Ensembl Gene ENSMUSG00000045205
Gene Name dpy-19-like 4 (C. elegans)
Synonyms Narg3, LOC381510
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1355 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 11261315-11322137 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 11303371 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 183 (W183*)
Ref Sequence ENSEMBL: ENSMUSP00000119923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084892] [ENSMUST00000128024] [ENSMUST00000139385] [ENSMUST00000142005]
AlphaFold A2AJQ3
Predicted Effect probably null
Transcript: ENSMUST00000084892
AA Change: W183*
SMART Domains Protein: ENSMUSP00000081954
Gene: ENSMUSG00000045205
AA Change: W183*

DomainStartEndE-ValueType
Pfam:Dpy19 59 714 3e-213 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128024
AA Change: W183*
SMART Domains Protein: ENSMUSP00000122823
Gene: ENSMUSG00000045205
AA Change: W183*

DomainStartEndE-ValueType
Pfam:Dpy19 58 293 1e-89 PFAM
Pfam:Dpy19 291 524 4.8e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139385
SMART Domains Protein: ENSMUSP00000115537
Gene: ENSMUSG00000045205

DomainStartEndE-ValueType
Pfam:Dpy19 1 258 3.2e-71 PFAM
Pfam:Dpy19 254 488 7e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142005
AA Change: W183*
SMART Domains Protein: ENSMUSP00000119923
Gene: ENSMUSG00000045205
AA Change: W183*

DomainStartEndE-ValueType
Pfam:Dpy19 58 253 6.9e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144941
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Dpy19l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dpy19l4 APN 4 11290411 missense probably benign 0.00
IGL01402:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01404:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01643:Dpy19l4 APN 4 11290184 splice site probably benign
IGL01758:Dpy19l4 APN 4 11265846 missense probably damaging 1.00
IGL01896:Dpy19l4 APN 4 11267752 missense possibly damaging 0.81
IGL02222:Dpy19l4 APN 4 11281116 missense possibly damaging 0.93
IGL02314:Dpy19l4 APN 4 11267720 missense possibly damaging 0.50
IGL02422:Dpy19l4 APN 4 11265803 missense possibly damaging 0.95
IGL02565:Dpy19l4 APN 4 11309440 missense probably benign 0.14
IGL03121:Dpy19l4 APN 4 11303334 missense probably damaging 1.00
IGL03357:Dpy19l4 APN 4 11267615 missense probably damaging 1.00
IGL03368:Dpy19l4 APN 4 11290253 missense possibly damaging 0.53
R0003:Dpy19l4 UTSW 4 11267619 missense probably damaging 1.00
R0481:Dpy19l4 UTSW 4 11272993 splice site probably benign
R0506:Dpy19l4 UTSW 4 11289715 missense probably benign 0.07
R1114:Dpy19l4 UTSW 4 11287643 splice site probably benign
R1332:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1336:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1421:Dpy19l4 UTSW 4 11304011 missense probably benign 0.09
R1422:Dpy19l4 UTSW 4 11317168 missense possibly damaging 0.88
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1766:Dpy19l4 UTSW 4 11303360 missense probably damaging 1.00
R1803:Dpy19l4 UTSW 4 11281020 missense possibly damaging 0.81
R2090:Dpy19l4 UTSW 4 11304344 missense probably benign 0.34
R2324:Dpy19l4 UTSW 4 11276857 unclassified probably benign
R2446:Dpy19l4 UTSW 4 11304143 splice site probably null
R3769:Dpy19l4 UTSW 4 11276868 splice site probably null
R4151:Dpy19l4 UTSW 4 11309485 missense possibly damaging 0.89
R4472:Dpy19l4 UTSW 4 11304053 missense possibly damaging 0.91
R4609:Dpy19l4 UTSW 4 11295999 nonsense probably null
R4708:Dpy19l4 UTSW 4 11277970 missense probably benign 0.00
R4722:Dpy19l4 UTSW 4 11290521 missense possibly damaging 0.84
R4997:Dpy19l4 UTSW 4 11287493 missense probably benign 0.01
R5085:Dpy19l4 UTSW 4 11265943 critical splice acceptor site probably null
R5088:Dpy19l4 UTSW 4 11303357 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11289721 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11304014 missense probably damaging 1.00
R5413:Dpy19l4 UTSW 4 11289700 missense probably damaging 1.00
R5758:Dpy19l4 UTSW 4 11276886 missense probably damaging 1.00
R6024:Dpy19l4 UTSW 4 11276876 missense probably damaging 1.00
R6312:Dpy19l4 UTSW 4 11289671 nonsense probably null
R6339:Dpy19l4 UTSW 4 11285111 missense probably damaging 0.98
R7055:Dpy19l4 UTSW 4 11290291 critical splice acceptor site probably null
R7359:Dpy19l4 UTSW 4 11273125 missense probably benign 0.00
R7525:Dpy19l4 UTSW 4 11317160 nonsense probably null
R7579:Dpy19l4 UTSW 4 11265909 missense probably benign 0.39
R7913:Dpy19l4 UTSW 4 11265859 nonsense probably null
R8047:Dpy19l4 UTSW 4 11317139 missense probably benign 0.00
R8049:Dpy19l4 UTSW 4 11303982 missense probably benign 0.44
R8495:Dpy19l4 UTSW 4 11267659 missense probably benign
R8911:Dpy19l4 UTSW 4 11317078 missense possibly damaging 0.82
R8928:Dpy19l4 UTSW 4 11304674 intron probably benign
R8955:Dpy19l4 UTSW 4 11290195 missense probably benign 0.00
R9332:Dpy19l4 UTSW 4 11304298 critical splice donor site probably null
R9372:Dpy19l4 UTSW 4 11303343 missense possibly damaging 0.91
R9401:Dpy19l4 UTSW 4 11265806 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGGAGTCCTACCTAATCGTCACCATC -3'
(R):5'- CTATCAAGCAACTGGCAGCAATGTATG -3'

Sequencing Primer
(F):5'- TCAAACATAACAATCAATAGGTTTGC -3'
(R):5'- attcaaaacagtagcaaaatgacag -3'
Posted On 2014-02-11