Mutagenetix > Incidental Mutations

Incidental Mutation 'R1355:Susd1'

156268

Institutional Source

Beutler Lab

Gene Symbol

Susd1

Ensembl Gene

ENSMUSG00000038578

Gene Name

sushi domain containing 1

Synonyms

Gm12528

MMRRC Submission

039420-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R1355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59314683-59438633 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 59424114 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 37 (C37Y)

Ref Sequence

ENSEMBL: ENSMUSP00000103168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040166
AA Change: C90Y

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: C90Y

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	16	30	N/A	INTRINSIC
EGF	43	77	1.36e1	SMART
EGF_CA	78	129	2.92e-7	SMART
EGF_CA	130	180	2.22e-12	SMART
CCP	184	239	7.87e-9	SMART
CCP	244	299	5.48e-8	SMART
Blast:FN3	306	379	2e-6	BLAST
Blast:FN3	459	580	8e-50	BLAST
transmembrane domain	729	751	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107544
AA Change: C37Y

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: C37Y

Domain	Start	End	E-Value	Type
EGF	28	76	2.02e-1	SMART
EGF_CA	77	127	2.22e-12	SMART
CCP	131	186	7.87e-9	SMART
CCP	191	246	5.48e-8	SMART
Blast:FN3	253	326	2e-6	BLAST
Blast:FN3	406	527	4e-50	BLAST
transmembrane domain	676	698	N/A	INTRINSIC

Meta Mutation Damage Score

0.9742

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
B4galnt4	T	C	7: 141,065,395	V259A	probably damaging	Het
Ccdc141	A	T	2: 77,030,601	I944N	probably damaging	Het
Ccdc146	A	T	5: 21,321,242	D224E	probably damaging	Het
Ccne1	A	G	7: 38,106,322	I43T	possibly damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cebpz	G	T	17: 78,935,324	D300E	probably benign	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dpy19l4	C	T	4: 11,303,371	W183*	probably null	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Erc1	A	T	6: 119,743,420	L440*	probably null	Het
Fam71e1	A	G	7: 44,496,691	K2E	possibly damaging	Het
Frem3	A	G	8: 80,690,702	Y2012C	probably damaging	Het
Gm10288	A	T	3: 146,838,993		noncoding transcript	Het
Gm1110	T	A	9: 26,883,761	K476N	probably benign	Het
Gm11937	A	T	11: 99,609,907	S95T	possibly damaging	Het
Hist1h2bl	T	A	13: 21,715,857	Q96L	probably damaging	Het
Hs6st1	T	A	1: 36,103,576	H197Q	probably damaging	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Nlrp2	G	T	7: 5,327,491	N635K	possibly damaging	Het
Olfr140	G	A	2: 90,051,613	T237I	probably benign	Het
Olfr1466	T	A	19: 13,342,518	Y253*	probably null	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Plxna1	A	G	6: 89,320,766		probably benign	Het
Ppp4r1	A	T	17: 65,840,987	E924D	probably benign	Het
Prdm2	C	T	4: 143,131,963	V1586I	probably benign	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rgs16	A	T	1: 153,743,668	K140M	probably damaging	Het
Rgsl1	A	G	1: 153,807,761	M1T	probably null	Het
Setdb2	T	A	14: 59,417,441	K333N	probably damaging	Het
Sgo2a	A	G	1: 58,017,965	T1103A	possibly damaging	Het
Sik3	C	T	9: 46,195,872		probably benign	Het
Slc44a3	C	A	3: 121,531,671	G47V	probably damaging	Het
Snrpd1	G	A	18: 10,627,818	G103D	probably benign	Het
Soga3	A	T	10: 29,147,322	T222S	probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Uckl1	G	T	2: 181,573,376	T213K	probably damaging	Het
Usp38	T	C	8: 80,985,033	E791G	possibly damaging	Het
Vps13b	C	T	15: 35,422,454	R187C	probably damaging	Het
Vwa3a	A	G	7: 120,784,111	Y645C	probably damaging	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het

Other mutations in Susd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01630:Susd1	APN	4	59365817	missense	possibly damaging	0.85
IGL01705:Susd1	APN	4	59332931	splice site	probably benign
IGL01727:Susd1	APN	4	59412329	splice site	probably benign
IGL02015:Susd1	APN	4	59315745	missense	possibly damaging	0.86
IGL02102:Susd1	APN	4	59369636	missense	possibly damaging	0.70
IGL02351:Susd1	APN	4	59427985	nonsense	probably null
IGL02358:Susd1	APN	4	59427985	nonsense	probably null
IGL03210:Susd1	APN	4	59333035	critical splice acceptor site	probably null
IGL03258:Susd1	APN	4	59379655	missense	possibly damaging	0.73
R0612:Susd1	UTSW	4	59390561	splice site	probably benign
R0719:Susd1	UTSW	4	59329506	missense	possibly damaging	0.56
R0722:Susd1	UTSW	4	59379749	missense	possibly damaging	0.73
R1672:Susd1	UTSW	4	59411395	missense	probably damaging	0.98
R1677:Susd1	UTSW	4	59424089	missense	possibly damaging	0.85
R1921:Susd1	UTSW	4	59412191	missense	probably benign	0.03
R1933:Susd1	UTSW	4	59351695	missense	possibly damaging	0.72
R1998:Susd1	UTSW	4	59349925	missense	probably benign	0.03
R2202:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2203:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2204:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2329:Susd1	UTSW	4	59379715	missense	possibly damaging	0.85
R2510:Susd1	UTSW	4	59349855	missense	possibly damaging	0.86
R4512:Susd1	UTSW	4	59329491	missense	possibly damaging	0.96
R4732:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R4733:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R4969:Susd1	UTSW	4	59351679	missense	probably benign	0.04
R5121:Susd1	UTSW	4	59379657	missense	possibly damaging	0.73
R5548:Susd1	UTSW	4	59369577	missense	probably benign	0.05
R5747:Susd1	UTSW	4	59424108	missense	probably damaging	0.98
R5776:Susd1	UTSW	4	59315363	utr 3 prime	probably benign
R5875:Susd1	UTSW	4	59412203	missense	possibly damaging	0.71
R6056:Susd1	UTSW	4	59379687	missense	possibly damaging	0.53
R6081:Susd1	UTSW	4	59411359	missense	possibly damaging	0.86
R7018:Susd1	UTSW	4	59390627	missense	probably benign	0.44
R7122:Susd1	UTSW	4	59411318	nonsense	probably null
R7161:Susd1	UTSW	4	59329581	missense	possibly damaging	0.85
R7172:Susd1	UTSW	4	59315420	splice site	probably null
R7891:Susd1	UTSW	4	59349915	missense	possibly damaging	0.85
R7974:Susd1	UTSW	4	59349915	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GCACAAGGCTCTCGACCATGAC -3'
(R):5'- CCTGCGGTTTCTTATACAGCGGGTA -3'

Sequencing Primer
(F):5'- TCTCGACCATGACCCCAC -3'
(R):5'- AGCTCCTTTTAGCCTGGAAAAC -3'

Posted On

2014-02-11