Incidental Mutation 'R1355:Wasf3'
ID 156272
Institutional Source Beutler Lab
Gene Symbol Wasf3
Ensembl Gene ENSMUSG00000029636
Gene Name WAS protein family, member 3
Synonyms Wave3
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1355 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 146384985-146473615 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 146470208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016143]
AlphaFold Q8VHI6
Predicted Effect probably benign
Transcript: ENSMUST00000016143
SMART Domains Protein: ENSMUSP00000016143
Gene: ENSMUSG00000029636

DomainStartEndE-ValueType
PDB:3P8C|D 1 171 1e-86 PDB
low complexity region 172 184 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 395 422 N/A INTRINSIC
WH2 439 456 4.97e-5 SMART
low complexity region 484 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. A pseudogene of this gene have been defined on chromosome 6. Alternative splicing results in multiple transcript variants [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Plxna1 A G 6: 89,320,766 probably benign Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Other mutations in Wasf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wasf3 APN 5 146455651 missense probably damaging 1.00
IGL01992:Wasf3 APN 5 146455591 missense probably damaging 1.00
IGL02866:Wasf3 APN 5 146468321 missense probably benign 0.28
FR4737:Wasf3 UTSW 5 146470250 missense probably damaging 0.99
R0622:Wasf3 UTSW 5 146466792 splice site probably null
R1083:Wasf3 UTSW 5 146435372 missense probably damaging 1.00
R1214:Wasf3 UTSW 5 146470288 missense probably damaging 1.00
R1259:Wasf3 UTSW 5 146451976 missense probably damaging 1.00
R1370:Wasf3 UTSW 5 146470208 splice site probably benign
R1727:Wasf3 UTSW 5 146466959 missense probably benign
R4837:Wasf3 UTSW 5 146460978 missense probably benign 0.16
R5080:Wasf3 UTSW 5 146461097 missense probably benign
R6046:Wasf3 UTSW 5 146470356 missense unknown
R6386:Wasf3 UTSW 5 146453417 missense possibly damaging 0.77
R7181:Wasf3 UTSW 5 146466805 missense probably benign
R7229:Wasf3 UTSW 5 146455653 missense probably damaging 1.00
R8438:Wasf3 UTSW 5 146453427 missense probably benign
R8830:Wasf3 UTSW 5 146466862 nonsense probably null
R8909:Wasf3 UTSW 5 146455600 missense
R9182:Wasf3 UTSW 5 146466825 nonsense probably null
R9287:Wasf3 UTSW 5 146461047 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTGTCAAAGGGCAATGCTAAGTGC -3'
(R):5'- TGCCTCAGTCAGACCAGTCATTCTC -3'

Sequencing Primer
(F):5'- AGTGCTTCATGTTAAGCCACC -3'
(R):5'- GTCATTCTCATCAAACTCAGAGTCG -3'
Posted On 2014-02-11