Mutagenetix > Incidental Mutation

Incidental Mutation 'R1355:Plxna1'

156275

Institutional Source

Beutler Lab

Gene Symbol

Plxna1

Ensembl Gene

ENSMUSG00000030084

Gene Name

plexin A1

Synonyms

NOV, Plxn1, PlexA1, 2600013D04Rik

MMRRC Submission

039420-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.885) question?

Stock #

R1355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89316314-89362620 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 89320766 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]

AlphaFold

P70206

Predicted Effect

probably benign
Transcript: ENSMUST00000049845

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163139

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181258

Predicted Effect

probably benign
Transcript: ENSMUST00000204468

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205230

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

100% (57/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
B4galnt4	T	C	7: 141,065,395	V259A	probably damaging	Het
Ccdc141	A	T	2: 77,030,601	I944N	probably damaging	Het
Ccdc146	A	T	5: 21,321,242	D224E	probably damaging	Het
Ccne1	A	G	7: 38,106,322	I43T	possibly damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cebpz	G	T	17: 78,935,324	D300E	probably benign	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dpy19l4	C	T	4: 11,303,371	W183*	probably null	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Erc1	A	T	6: 119,743,420	L440*	probably null	Het
Fam71e1	A	G	7: 44,496,691	K2E	possibly damaging	Het
Frem3	A	G	8: 80,690,702	Y2012C	probably damaging	Het
Gm10288	A	T	3: 146,838,993		noncoding transcript	Het
Gm1110	T	A	9: 26,883,761	K476N	probably benign	Het
Gm11937	A	T	11: 99,609,907	S95T	possibly damaging	Het
Hist1h2bl	T	A	13: 21,715,857	Q96L	probably damaging	Het
Hs6st1	T	A	1: 36,103,576	H197Q	probably damaging	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Nlrp2	G	T	7: 5,327,491	N635K	possibly damaging	Het
Olfr140	G	A	2: 90,051,613	T237I	probably benign	Het
Olfr1466	T	A	19: 13,342,518	Y253*	probably null	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Ppp4r1	A	T	17: 65,840,987	E924D	probably benign	Het
Prdm2	C	T	4: 143,131,963	V1586I	probably benign	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rgs16	A	T	1: 153,743,668	K140M	probably damaging	Het
Rgsl1	A	G	1: 153,807,761	M1T	probably null	Het
Setdb2	T	A	14: 59,417,441	K333N	probably damaging	Het
Sgo2a	A	G	1: 58,017,965	T1103A	possibly damaging	Het
Sik3	C	T	9: 46,195,872		probably benign	Het
Slc44a3	C	A	3: 121,531,671	G47V	probably damaging	Het
Snrpd1	G	A	18: 10,627,818	G103D	probably benign	Het
Soga3	A	T	10: 29,147,322	T222S	probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Susd1	C	T	4: 59,424,114	C37Y	possibly damaging	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Uckl1	G	T	2: 181,573,376	T213K	probably damaging	Het
Usp38	T	C	8: 80,985,033	E791G	possibly damaging	Het
Vps13b	C	T	15: 35,422,454	R187C	probably damaging	Het
Vwa3a	A	G	7: 120,784,111	Y645C	probably damaging	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het

Other mutations in Plxna1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Plxna1	APN	6	89320998	missense	probably damaging	1.00
IGL01358:Plxna1	APN	6	89322750	missense	probably damaging	1.00
IGL01475:Plxna1	APN	6	89354888	missense	possibly damaging	0.92
IGL01480:Plxna1	APN	6	89344096	missense	possibly damaging	0.70
IGL01585:Plxna1	APN	6	89329556	critical splice donor site	probably null
IGL01804:Plxna1	APN	6	89329646	missense	probably damaging	1.00
IGL01909:Plxna1	APN	6	89332084	critical splice donor site	probably null
IGL01989:Plxna1	APN	6	89329414	nonsense	probably null
IGL02015:Plxna1	APN	6	89342451	missense	probably damaging	1.00
IGL02023:Plxna1	APN	6	89357332	missense	possibly damaging	0.88
IGL02668:Plxna1	APN	6	89357269	nonsense	probably null
IGL02703:Plxna1	APN	6	89356943	missense	probably damaging	1.00
IGL02954:Plxna1	APN	6	89324667	missense	probably damaging	1.00
IGL03212:Plxna1	APN	6	89331903	missense	probably damaging	1.00
PIT4544001:Plxna1	UTSW	6	89357429	missense	probably benign	0.14
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0147:Plxna1	UTSW	6	89320710	missense	possibly damaging	0.95
R0149:Plxna1	UTSW	6	89320613	missense	probably null	0.95
R0166:Plxna1	UTSW	6	89333019	missense	probably damaging	1.00
R0200:Plxna1	UTSW	6	89323593	missense	probably damaging	1.00
R0415:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
R0841:Plxna1	UTSW	6	89332204	missense	probably damaging	1.00
R1018:Plxna1	UTSW	6	89342960	missense	probably damaging	1.00
R1240:Plxna1	UTSW	6	89321050	missense	probably damaging	1.00
R1700:Plxna1	UTSW	6	89357008	missense	probably damaging	1.00
R1776:Plxna1	UTSW	6	89335464	missense	probably benign	0.00
R1957:Plxna1	UTSW	6	89331291	missense	probably damaging	1.00
R2314:Plxna1	UTSW	6	89324316	missense	probably damaging	1.00
R2968:Plxna1	UTSW	6	89342608	missense	probably damaging	1.00
R3118:Plxna1	UTSW	6	89356976	missense	possibly damaging	0.89
R3522:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R3619:Plxna1	UTSW	6	89357453	missense	probably damaging	0.97
R3766:Plxna1	UTSW	6	89334775	unclassified	probably benign
R3847:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3849:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3872:Plxna1	UTSW	6	89332692	nonsense	probably null
R4555:Plxna1	UTSW	6	89323328	missense	probably damaging	0.99
R4709:Plxna1	UTSW	6	89334751	missense	possibly damaging	0.72
R4726:Plxna1	UTSW	6	89322816	missense	probably damaging	1.00
R4739:Plxna1	UTSW	6	89332675	splice site	probably null
R5053:Plxna1	UTSW	6	89322460	missense	probably damaging	1.00
R5221:Plxna1	UTSW	6	89321016	missense	probably damaging	1.00
R5449:Plxna1	UTSW	6	89323608	missense	probably damaging	1.00
R5480:Plxna1	UTSW	6	89324634	missense	probably damaging	1.00
R5575:Plxna1	UTSW	6	89324541	missense	possibly damaging	0.83
R5743:Plxna1	UTSW	6	89356529	missense	probably damaging	1.00
R5744:Plxna1	UTSW	6	89334682	missense	possibly damaging	0.67
R5754:Plxna1	UTSW	6	89333105	missense	possibly damaging	0.96
R5868:Plxna1	UTSW	6	89322722	splice site	probably benign
R5988:Plxna1	UTSW	6	89357540	nonsense	probably null
R6190:Plxna1	UTSW	6	89356604	nonsense	probably null
R6425:Plxna1	UTSW	6	89334665	missense	probably benign	0.00
R6561:Plxna1	UTSW	6	89356978	missense	probably damaging	1.00
R6623:Plxna1	UTSW	6	89322771	missense	probably damaging	1.00
R6638:Plxna1	UTSW	6	89324400	missense	probably damaging	0.97
R6701:Plxna1	UTSW	6	89319448	missense	probably damaging	0.99
R6825:Plxna1	UTSW	6	89320615	missense	probably benign	0.01
R6911:Plxna1	UTSW	6	89320974	missense	probably damaging	1.00
R7073:Plxna1	UTSW	6	89357329	missense	probably damaging	1.00
R7177:Plxna1	UTSW	6	89323329	missense	possibly damaging	0.50
R7235:Plxna1	UTSW	6	89340591	missense	probably damaging	0.97
R7419:Plxna1	UTSW	6	89357602	missense	unknown
R7511:Plxna1	UTSW	6	89341907	missense	possibly damaging	0.71
R7543:Plxna1	UTSW	6	89322855	missense	probably damaging	1.00
R7665:Plxna1	UTSW	6	89324538	critical splice donor site	probably null
R7678:Plxna1	UTSW	6	89331900	missense	probably damaging	0.99
R7748:Plxna1	UTSW	6	89337352	critical splice acceptor site	probably null
R7748:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R7877:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
R8025:Plxna1	UTSW	6	89331272	missense	probably damaging	1.00
R8171:Plxna1	UTSW	6	89357120	missense	probably benign	0.20
R8277:Plxna1	UTSW	6	89357180	missense	probably damaging	1.00
R8782:Plxna1	UTSW	6	89323238	missense	probably damaging	1.00
R8867:Plxna1	UTSW	6	89333097	missense	probably benign	0.00
R9245:Plxna1	UTSW	6	89337338	missense	probably damaging	1.00
R9253:Plxna1	UTSW	6	89357540	nonsense	probably null
R9269:Plxna1	UTSW	6	89329559	missense	probably null	1.00
R9273:Plxna1	UTSW	6	89319382	missense	possibly damaging	0.77
R9281:Plxna1	UTSW	6	89323331	missense	probably damaging	1.00
R9368:Plxna1	UTSW	6	89337156	missense	probably benign
R9440:Plxna1	UTSW	6	89341930	missense	probably benign	0.00
R9526:Plxna1	UTSW	6	89342651	missense	probably benign
R9601:Plxna1	UTSW	6	89331271	missense	probably damaging	1.00
R9714:Plxna1	UTSW	6	89319458	missense	probably damaging	0.99
R9782:Plxna1	UTSW	6	89356835	missense	probably benign	0.01
S24628:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
V8831:Plxna1	UTSW	6	89357137	missense	probably damaging	0.99
Z1176:Plxna1	UTSW	6	89321052	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAAACCACTGTCACCCTGTCTC -3'
(R):5'- ACCCTCCAACAAGTTGCTCTATGC -3'

Sequencing Primer
(F):5'- CTAGGAAAATCTGGGCTGTCAGATAC -3'
(R):5'- CAAGTTGCTCTATGCCAAGG -3'

Posted On

2014-02-11