Incidental Mutation 'R1355:Plxna1'
ID156275
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Nameplexin A1
SynonymsNOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission 039420-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R1355 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location89316314-89362620 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 89320766 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
Predicted Effect probably benign
Transcript: ENSMUST00000049845
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163139
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181258
Predicted Effect probably benign
Transcript: ENSMUST00000204468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205230
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
B4galnt4 T C 7: 141,065,395 V259A probably damaging Het
Ccdc141 A T 2: 77,030,601 I944N probably damaging Het
Ccdc146 A T 5: 21,321,242 D224E probably damaging Het
Ccne1 A G 7: 38,106,322 I43T possibly damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cebpz G T 17: 78,935,324 D300E probably benign Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dpy19l4 C T 4: 11,303,371 W183* probably null Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Erc1 A T 6: 119,743,420 L440* probably null Het
Fam71e1 A G 7: 44,496,691 K2E possibly damaging Het
Frem3 A G 8: 80,690,702 Y2012C probably damaging Het
Gm10288 A T 3: 146,838,993 noncoding transcript Het
Gm1110 T A 9: 26,883,761 K476N probably benign Het
Gm11937 A T 11: 99,609,907 S95T possibly damaging Het
Hist1h2bl T A 13: 21,715,857 Q96L probably damaging Het
Hs6st1 T A 1: 36,103,576 H197Q probably damaging Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Nlrp2 G T 7: 5,327,491 N635K possibly damaging Het
Olfr140 G A 2: 90,051,613 T237I probably benign Het
Olfr1466 T A 19: 13,342,518 Y253* probably null Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Ppp4r1 A T 17: 65,840,987 E924D probably benign Het
Prdm2 C T 4: 143,131,963 V1586I probably benign Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rgs16 A T 1: 153,743,668 K140M probably damaging Het
Rgsl1 A G 1: 153,807,761 M1T probably null Het
Setdb2 T A 14: 59,417,441 K333N probably damaging Het
Sgo2a A G 1: 58,017,965 T1103A possibly damaging Het
Sik3 C T 9: 46,195,872 probably benign Het
Slc44a3 C A 3: 121,531,671 G47V probably damaging Het
Snrpd1 G A 18: 10,627,818 G103D probably benign Het
Soga3 A T 10: 29,147,322 T222S probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Susd1 C T 4: 59,424,114 C37Y possibly damaging Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Uckl1 G T 2: 181,573,376 T213K probably damaging Het
Usp38 T C 8: 80,985,033 E791G possibly damaging Het
Vps13b C T 15: 35,422,454 R187C probably damaging Het
Vwa3a A G 7: 120,784,111 Y645C probably damaging Het
Wasf3 T C 5: 146,470,208 probably benign Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89357429 missense probably benign 0.14
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89320710 missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89321050 missense probably damaging 1.00
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89332692 nonsense probably null
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89323608 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89357329 missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89323329 missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89340591 missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89357602 missense unknown
R7511:Plxna1 UTSW 6 89341907 missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89322855 missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89324538 critical splice donor site probably null
R7678:Plxna1 UTSW 6 89331900 missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89337352 critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89323259 missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89331272 missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89357120 missense probably benign 0.20
R8277:Plxna1 UTSW 6 89357180 missense probably damaging 1.00
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89321052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAACCACTGTCACCCTGTCTC -3'
(R):5'- ACCCTCCAACAAGTTGCTCTATGC -3'

Sequencing Primer
(F):5'- CTAGGAAAATCTGGGCTGTCAGATAC -3'
(R):5'- CAAGTTGCTCTATGCCAAGG -3'
Posted On2014-02-11